Transcript: Mouse NM_008907.1

Mus musculus peptidylprolyl isomerase A (Ppia), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ppia (268373)
Length:
736
CDS:
42..536

Additional Resources:

NCBI RefSeq record:
NM_008907.1
NBCI Gene record:
Ppia (268373)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008907.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049169 GAGAACTTCATCCTAAAGCAT pLKO.1 297 CDS 100% 3.000 1.800 N PPIA n/a
2 TRCN0000101191 CCAGCAAGAAGATCACCATTT pLKO.1 496 CDS 100% 10.800 5.400 Y Ppia n/a
3 TRCN0000309763 CCAGCAAGAAGATCACCATTT pLKO_005 496 CDS 100% 10.800 5.400 Y Ppia n/a
4 TRCN0000431721 GCATCTTGTCCATGGCAAATG pLKO_005 328 CDS 100% 10.800 5.400 Y PPIAL4A n/a
5 TRCN0000377627 GGCATCTTGTCCATGGCAAAT pLKO_005 327 CDS 100% 10.800 5.400 Y PPIAL4A n/a
6 TRCN0000049168 ACCAGCAAGAAGATCACCATT pLKO.1 495 CDS 100% 4.950 2.475 Y PPIA n/a
7 TRCN0000101190 CATCAAACCATTCCTTCTGTA pLKO.1 564 3UTR 100% 4.950 2.475 Y Ppia n/a
8 TRCN0000309687 CATCAAACCATTCCTTCTGTA pLKO_005 564 3UTR 100% 4.950 2.475 Y Ppia n/a
9 TRCN0000101193 CATGGCAAATGCTGGACCAAA pLKO.1 338 CDS 100% 4.950 2.475 Y Ppia n/a
10 TRCN0000049231 GAATGGCAAGACCAGCAAGAA pLKO.1 485 CDS 100% 4.950 2.475 Y PPIA n/a
11 TRCN0000049274 GATGGCAAGCATGTGGTCTTT pLKO.1 408 CDS 100% 4.950 2.475 Y PPIAP43 n/a
12 TRCN0000101194 TCACAGAATTATTCCAGGATT pLKO.1 200 CDS 100% 4.950 2.475 Y Ppia n/a
13 TRCN0000309689 TCACAGAATTATTCCAGGATT pLKO_005 200 CDS 100% 4.950 2.475 Y Ppia n/a
14 TRCN0000101192 GTGGTGACTTTACACGCCATA pLKO.1 232 CDS 100% 4.050 2.025 Y Ppia n/a
15 TRCN0000309688 GTGGTGACTTTACACGCCATA pLKO_005 232 CDS 100% 4.050 2.025 Y Ppia n/a
16 TRCN0000049191 TGGCATCTTGTCCATGGCAAA pLKO.1 326 CDS 100% 4.050 2.025 Y LOC390299 n/a
17 TRCN0000365646 CATCTTGTCCATGGCAAATTC pLKO_005 329 CDS 100% 13.200 6.600 Y PPIAP80 n/a
18 TRCN0000049172 CTGGAGAGAAAGGATTTGGTT pLKO.1 163 CDS 100% 3.000 1.500 Y PPIA n/a
19 TRCN0000203719 CTGGAGAGAAAGGATTTGGTT pLKO.1 163 CDS 100% 3.000 1.500 Y LOC343384 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008907.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01252 pDONR223 100% 91.9% 95.7% None (many diffs) n/a
2 ccsbBroad304_01252 pLX_304 0% 91.9% 95.7% V5 (many diffs) n/a
3 TRCN0000478189 GGCAGTTCATAACCTTCGCACTTT pLX_317 46.2% 91.9% 95.7% V5 (many diffs) n/a
4 TRCN0000491637 CTCGAAGCCATCATTCTCCAGACG pLX_317 31.8% 91.9% 95.7% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_15534 pDONR223 0% 91.7% 95.1% None (many diffs) n/a
6 ccsbBroad304_15534 pLX_304 0% 91.7% 95.1% V5 (many diffs) n/a
7 TRCN0000473942 CGAGAGCTCGCACCGATCTTACTC pLX_317 69.1% 91.7% 95.1% V5 (many diffs) n/a
8 ccsbBroadEn_06756 pDONR223 100% 91.7% 95.1% None (many diffs) n/a
9 ccsbBroad304_06756 pLX_304 0% 91.7% 95.1% V5 (many diffs) n/a
10 TRCN0000467900 CATAACTCCTGAGAAGATCCAAAT pLX_317 64.8% 91.7% 95.1% V5 (many diffs) n/a
11 ccsbBroadEn_10188 pDONR223 100% 88.8% 84.1% None (many diffs) n/a
12 ccsbBroad304_10188 pLX_304 0% 88.8% 84.1% V5 (many diffs) n/a
13 TRCN0000480018 TCTCTTGGGAGGTGCATTCGATCA pLX_317 83.1% 88.8% 84.1% V5 (many diffs) n/a
Download CSV