Transcript: Human NM_001368128.1

Homo sapiens peptidylprolyl isomerase A like 4H (PPIAL4H), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
PPIAL4H (105371242)
Length:
2573
CDS:
193..687

Additional Resources:

NCBI RefSeq record:
NM_001368128.1
NBCI Gene record:
PPIAL4H (105371242)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001368128.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255863 AGAGAAAGGATTTCGTTATAA pLKO_005 318 CDS 100% 15.000 7.500 Y PPIAL4C n/a
2 TRCN0000371064 GTGAAAGAACGTGTGAATATT pLKO_005 586 CDS 100% 15.000 7.500 Y PPIAL4A n/a
3 TRCN0000255862 TCCTGCTTTCACAGAATTATT pLKO_005 343 CDS 100% 15.000 7.500 Y PPIAL4C n/a
4 TRCN0000337286 AGAATTATTCCAGGGTTTATG pLKO_005 355 CDS 100% 13.200 6.600 Y PPIAL4A n/a
5 TRCN0000256034 CAGAATTATTCCAGGGTTTAT pLKO_005 354 CDS 100% 13.200 6.600 Y PPIAL4G n/a
6 TRCN0000337229 CATTGCTGACTGTGGACAATT pLKO_005 663 CDS 100% 13.200 6.600 Y PPIAL4A n/a
7 TRCN0000337244 CCTGCTTTCACAGAATTATTC pLKO_005 344 CDS 100% 13.200 6.600 Y PPIAL4E n/a
8 TRCN0000255866 CTGACTGTGGACAATTCTAAT pLKO_005 668 CDS 100% 13.200 6.600 Y PPIAL4C n/a
9 TRCN0000350856 GAGAAAGGATTTCGTTATAAG pLKO_005 319 CDS 100% 13.200 6.600 Y PPIAL4A n/a
10 TRCN0000256032 GAGAGAAAGGATTTCGTTATA pLKO_005 317 CDS 100% 13.200 6.600 Y PPIAL4G n/a
11 TRCN0000049232 GTTCCTGCTTTCACAGAATTA pLKO.1 341 CDS 100% 13.200 6.600 Y PPIA n/a
12 TRCN0000147390 GTTCCTGCTTTCACAGAATTA pLKO.1 341 CDS 100% 13.200 6.600 Y PPIAL4A n/a
13 TRCN0000371120 GCACTTTGGGTACAGGAATAG pLKO_005 621 CDS 100% 10.800 5.400 Y PPIAL4A n/a
14 TRCN0000337245 GGAGAGAAAGGATTTCGTTAT pLKO_005 316 CDS 100% 10.800 5.400 Y PPIAL4E n/a
15 TRCN0000337246 GGTGACTTCACACGCCCTAAT pLKO_005 385 CDS 100% 10.800 5.400 Y PPIAL4E n/a
16 TRCN0000049168 ACCAGCAAGAAGATCACCATT pLKO.1 646 CDS 100% 4.950 2.475 Y PPIA n/a
17 TRCN0000148332 CAAGGTGAAAGAACGTGTGAA pLKO.1 582 CDS 100% 4.950 2.475 Y PPIAL4A n/a
18 TRCN0000148414 CGCATCTCCATCAAACTGTTT pLKO.1 247 CDS 100% 4.950 2.475 Y PPIAL4A n/a
19 TRCN0000084008 CGCCTATAATCCCAGCACTTT pLKO.1 2526 3UTR 100% 4.950 2.475 Y NPHS1 n/a
20 TRCN0000419029 ATGAGAACCTCATCCGAAAGC pLKO_005 446 CDS 100% 4.050 2.025 Y PPIAL4A n/a
21 TRCN0000049144 CACAGAATTATTCCAGGGTTT pLKO.1 352 CDS 100% 4.050 2.025 Y PPIAP55 n/a
22 TRCN0000148738 CTGGAGAGAAAGGATTTCGTT pLKO.1 314 CDS 100% 3.000 1.500 Y PPIAL4A n/a
23 TRCN0000149832 CTTTGGGTACAGGAATAGCAA pLKO.1 624 CDS 100% 3.000 1.500 Y PPIAL4A n/a
24 TRCN0000049277 GCCAAGACTGAGTGGTTGGAT pLKO.1 541 CDS 100% 3.000 1.500 Y PPIAP43 n/a
25 TRCN0000147620 GAACGTGTGAATATTGTGGAA pLKO.1 592 CDS 100% 2.640 1.320 Y PPIAL4A n/a
26 TRCN0000101191 CCAGCAAGAAGATCACCATTT pLKO.1 647 CDS 100% 10.800 5.400 Y Ppia n/a
27 TRCN0000309763 CCAGCAAGAAGATCACCATTT pLKO_005 647 CDS 100% 10.800 5.400 Y Ppia n/a
28 TRCN0000049272 CATTGCTGACTGTGGACAACT pLKO.1 663 CDS 100% 4.950 2.475 Y PPIAP31 n/a
29 TRCN0000256030 TTTCACCACCAGACCCATTCC pLKO_005 709 3UTR 100% 4.050 2.025 Y PPIAL4G n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001368128.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10188 pDONR223 100% 99.1% 98.1% None (many diffs) n/a
2 ccsbBroad304_10188 pLX_304 0% 99.1% 98.1% V5 (many diffs) n/a
3 TRCN0000480018 TCTCTTGGGAGGTGCATTCGATCA pLX_317 83.1% 99.1% 98.1% V5 (many diffs) n/a
4 ccsbBroadEn_01252 pDONR223 100% 91.1% 84.2% None (many diffs) n/a
5 ccsbBroad304_01252 pLX_304 0% 91.1% 84.2% V5 (many diffs) n/a
6 TRCN0000478189 GGCAGTTCATAACCTTCGCACTTT pLX_317 46.2% 91.1% 84.2% V5 (many diffs) n/a
7 TRCN0000491637 CTCGAAGCCATCATTCTCCAGACG pLX_317 31.8% 91.1% 84.2% V5 (not translated due to prior stop codon) (many diffs) n/a
8 ccsbBroadEn_15534 pDONR223 0% 90.9% 83.6% None (many diffs) n/a
9 ccsbBroad304_15534 pLX_304 0% 90.9% 83.6% V5 (many diffs) n/a
10 TRCN0000473942 CGAGAGCTCGCACCGATCTTACTC pLX_317 69.1% 90.9% 83.6% V5 (many diffs) n/a
11 ccsbBroadEn_06756 pDONR223 100% 90.9% 83.6% None (many diffs) n/a
12 ccsbBroad304_06756 pLX_304 0% 90.9% 83.6% V5 (many diffs) n/a
13 TRCN0000467900 CATAACTCCTGAGAAGATCCAAAT pLX_317 64.8% 90.9% 83.6% V5 (many diffs) n/a
Download CSV