Construct: ORF TRCN0000491646
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004239.1_s317c1
- Derived from:
- ccsbBroadEn_06321
- DNA Barcode:
- ATACAACCCAACAAAGTTTTTTTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GRK4 (2868)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491646
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 2868 | GRK4 | G protein-coupled receptor ... | NM_182982.3 | 99.9% | 99.8% | 1457T>C |
2 | human | 2868 | GRK4 | G protein-coupled receptor ... | NM_001004056.2 | 94.4% | 94.2% | 51_52ins96;1361T>C |
3 | human | 2868 | GRK4 | G protein-coupled receptor ... | XM_011513447.2 | 93.6% | 93.5% | 601_717del;1574T>C |
4 | human | 2868 | GRK4 | G protein-coupled receptor ... | NM_001004057.2 | 91.9% | 91.8% | 1457T>C;1544_1545ins138 |
5 | human | 2868 | GRK4 | G protein-coupled receptor ... | XM_011513448.2 | 90.9% | 89.6% | (many diffs) |
6 | human | 2868 | GRK4 | G protein-coupled receptor ... | XM_017008052.1 | 89.4% | 89.3% | 260_261ins78;523_639del;1496T>C |
7 | human | 2868 | GRK4 | G protein-coupled receptor ... | XM_017008053.1 | 88.7% | 88.6% | 601_717del;1086_1087ins90;1484T>C |
8 | human | 2868 | GRK4 | G protein-coupled receptor ... | XM_011513449.2 | 88.4% | 88.3% | 51_52ins96;505_621del;1478T>C |
9 | human | 2868 | GRK4 | G protein-coupled receptor ... | NM_005307.3 | 86.4% | 86.3% | 51_52ins96;1361T>C;1448_1449ins138 |
10 | human | 2868 | GRK4 | G protein-coupled receptor ... | XM_011513450.2 | 86.1% | 86% | 601_717del;1574T>C;1661_1662ins138 |
11 | human | 2868 | GRK4 | G protein-coupled receptor ... | XM_011513451.2 | 86.1% | 86% | 601_717del;1386_1387ins138;1436T>C |
12 | human | 2868 | GRK4 | G protein-coupled receptor ... | XM_017008054.1 | 84% | 83.9% | 1269_1270ins138;1319T>C;1406_1407ins138 |
13 | human | 2868 | GRK4 | G protein-coupled receptor ... | XM_011513452.2 | 83.5% | 82.2% | (many diffs) |
14 | human | 2868 | GRK4 | G protein-coupled receptor ... | XM_011513453.2 | 78.7% | 78.7% | 601_717del;1524_1525ins276 |
15 | human | 2868 | GRK4 | G protein-coupled receptor ... | XM_011513454.2 | 78.7% | 78.6% | (many diffs) |
16 | human | 2868 | GRK4 | G protein-coupled receptor ... | XM_017008055.1 | 78.4% | 78.3% | (many diffs) |
17 | human | 2868 | GRK4 | G protein-coupled receptor ... | XM_017008056.1 | 73.3% | 76.1% | (many diffs) |
18 | human | 2868 | GRK4 | G protein-coupled receptor ... | XM_011513455.2 | 68.7% | 71.3% | (many diffs) |
19 | human | 2868 | GRK4 | G protein-coupled receptor ... | NM_001350173.2 | 66.3% | 65.3% | 0_1ins518;16_17ins64;875T>C |
20 | human | 2868 | GRK4 | G protein-coupled receptor ... | XM_017008057.1 | 66.3% | 65.3% | 0_1ins518;16_17ins64;875T>C |
21 | human | 2868 | GRK4 | G protein-coupled receptor ... | XM_017008058.1 | 66.3% | 65.3% | 0_1ins518;16_17ins64;875T>C |
22 | human | 2868 | GRK4 | G protein-coupled receptor ... | XM_017008059.2 | 66.3% | 65.3% | 0_1ins518;16_17ins64;875T>C |
23 | human | 2868 | GRK4 | G protein-coupled receptor ... | XM_024454015.1 | 66.3% | 65.3% | 0_1ins518;16_17ins64;875T>C |
24 | human | 2868 | GRK4 | G protein-coupled receptor ... | XM_005247962.3 | 63.4% | 63.3% | 0_1ins633;824T>C |
25 | human | 2868 | GRK4 | G protein-coupled receptor ... | XM_006713880.3 | 63.4% | 63.3% | 0_1ins633;824T>C |
26 | human | 2868 | GRK4 | G protein-coupled receptor ... | XM_017008062.1 | 63.4% | 63.3% | 0_1ins633;824T>C |
27 | human | 2868 | GRK4 | G protein-coupled receptor ... | XR_924941.2 | 58.7% | (many diffs) | |
28 | human | 2868 | GRK4 | G protein-coupled receptor ... | XM_017008063.1 | 58.4% | 57.4% | (many diffs) |
29 | human | 2868 | GRK4 | G protein-coupled receptor ... | XM_017008064.1 | 58.4% | 57.4% | (many diffs) |
30 | human | 2868 | GRK4 | G protein-coupled receptor ... | XR_001741211.1 | 55.2% | (many diffs) | |
31 | human | 2868 | GRK4 | G protein-coupled receptor ... | XM_011513456.2 | 53.2% | 52.9% | (many diffs) |
32 | human | 2868 | GRK4 | G protein-coupled receptor ... | XM_017008066.1 | 50.4% | 49.4% | (many diffs) |
33 | human | 2868 | GRK4 | G protein-coupled receptor ... | XR_924943.2 | 49.7% | (many diffs) | |
34 | human | 2868 | GRK4 | G protein-coupled receptor ... | XR_001741210.1 | 43.8% | (many diffs) | |
35 | human | 2868 | GRK4 | G protein-coupled receptor ... | XM_011513457.2 | 42.3% | 40.8% | (many diffs) |
36 | human | 2868 | GRK4 | G protein-coupled receptor ... | XM_017008065.1 | 40.5% | 40.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1803
- ORF length:
- 1734
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggagctcgag aacatcgtgg ccaactcgct gctgctgaaa gcgcgtcaag 121 gaggatatgg caaaaaaagt ggtcgtagta aaaaatggaa ggagatactg acactgcctc 181 ctgtcagcca gtgcagtgag cttagacatt ccattgaaaa ggattatagc agtctttgtg 241 acaagcaacc gataggaaga cgtctcttca ggcagttctg tgataccaaa cccactctaa 301 agaggcacat tgaattcttg gatgcagtgg cagaatatga agttgccgat gatgaggacc 361 gaagtgattg tggactgtca atcttagata gattcttcaa tgataagttg gcagcccctt 421 taccagaaat acctccagat gttgtgacag aatgtagatt gggactgaag gaggagaacc 481 cttccaaaaa agcctttgag gaatgtacta gagttgccca taactaccta agaggggaac 541 catttgaaga ataccaagaa agctcatatt tttctcagtt tttacaatgg aaatggctgg 601 aaaggcaacc cgtaacaaag aacacattta gacattacag agttctagga aaaggcggat 661 ttggagaggt ttgcgcctgt caagtgcgag ccacaggaaa aatgtatgcc tgcaaaaagc 721 tacaaaaaaa aagaataaag aagaggaaag gtgaagctat ggctctaaat gagaaaagaa 781 ttctggagaa agtgcaaagt agattcgtag ttagtttagc ctacgcttat gaaaccaaag 841 atgccttgtg cttggtgctc accattatga atggagggga tttgaagttt cacatttaca 901 acctgggcaa tcccggcttt gatgagcaga gagccgtttt ctatgctgca gagctgtgtt 961 gcggcttgga agatttacag agggaaagaa ttgtatacag agacttgaag cctgagaata 1021 ttctccttga tgatcgtgga cacatccgga tttcagacct cggtttggcc acagagatcc 1081 cagaaggaca gagggttcga ggaagagttg gaacagtcgg ctacatggca cctgaagttg 1141 tcaataatga aaagtatacg tttagtcccg attggtgggg acttggctgt ctgatctatg 1201 aaatgattca gggacattct ccattcaaaa aatacaaaga gaaagtcaaa tgggaggagg 1261 tcgatcaaag aatcaagaat gataccgagg agtattctga gaagttttca gaggatgcca 1321 aatctatctg caggatgtta ctcaccaaga atccaagcaa gcggctgggc tgcaggggcg 1381 agggagcggc tggggtgaag cagcaccccg tgttcaagga catcaacttc aggaggctgg 1441 aggcaaacat gctggagccc cctttctgtc ctgatcctca tgccgtttac tgtaaggacg 1501 tcctggatat cgagcagttc tcGGCGGTGA AAGGGATCTA CCTGGACACC GCAGATGAAG 1561 ACTTCTATGC TCGGTTTGCT ACCGGGTGTG TCTCCATCCC CTGGCAGAAT GAGATGATCG 1621 AATCTGGGTG TTTCAAAGAC ATCAACAAAA GTGAAAGTGA GGAAGCTTTG CCATTAGATC 1681 TAGACAAGAA CATACATACC CCGGTTTCCA GACCAAACAG AGGCTTCTTC TATAGACTCT 1741 TCAGAAGAGG GGGCTGCCTG ACCATGGTCC CCAGTGAGAA GGAAGTGGAA CCCAAGCAAT 1801 GCTTGCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1861 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1921 GGCTTTATAT ATCTTGTGGA AAGGACGAAT ACAACCCAAC AAAGTTTTTT TCACGCGTTA 1981 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt