Transcript: Human XM_017008058.1

PREDICTED: Homo sapiens G protein-coupled receptor kinase 4 (GRK4), transcript variant X21, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GRK4 (2868)
Length:
1703
CDS:
414..1568

Additional Resources:

NCBI RefSeq record:
XM_017008058.1
NBCI Gene record:
GRK4 (2868)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008058.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196375 GCTTTGCCATTAGATCTAGAC pLKO.1 1428 CDS 100% 4.050 5.670 N GRK4 n/a
2 TRCN0000196675 GAATACCAAGAAAGCTCATAT pLKO.1 376 5UTR 100% 13.200 9.240 N GRK4 n/a
3 TRCN0000196505 GCAAAGTAGATTCGTAGTTAG pLKO.1 557 CDS 100% 10.800 7.560 N GRK4 n/a
4 TRCN0000000987 AGGATGTTACTCACCAAGAAT pLKO.1 1095 CDS 100% 5.625 3.938 N GRK4 n/a
5 TRCN0000000990 CTTGGCTGTCTGATCTATGAA pLKO.1 945 CDS 100% 5.625 3.938 N GRK4 n/a
6 TRCN0000000989 GAATATGAAGTTGCCGATGAT pLKO.1 108 5UTR 100% 4.950 3.465 N GRK4 n/a
7 TRCN0000000986 GCCTACGCTTATGAAACCAAA pLKO.1 582 CDS 100% 4.950 3.465 N GRK4 n/a
8 TRCN0000196888 GCTTCTTCTATAGACTCTTCA pLKO.1 1486 CDS 100% 4.950 3.465 N GRK4 n/a
9 TRCN0000194891 CTGTCAATCTTAGATAGATTC pLKO.1 150 5UTR 100% 1.080 0.756 N GRK4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008058.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06321 pDONR223 100% 66.3% 65.3% None 0_1ins518;16_17ins64;875T>C n/a
2 ccsbBroad304_06321 pLX_304 0% 66.3% 65.3% V5 0_1ins518;16_17ins64;875T>C n/a
3 TRCN0000491646 ATACAACCCAACAAAGTTTTTTTC pLX_317 16.5% 66.3% 65.3% V5 0_1ins518;16_17ins64;875T>C n/a
Download CSV