Construct: ORF TRCN0000491792
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014196.1_s317c1
- Derived from:
- ccsbBroadEn_09415
- DNA Barcode:
- GAGGTACCACATCTCCATCGTGGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FBXO17 (115290)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491792
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 115290 | FBXO17 | F-box protein 17 | NM_024907.7 | 99.7% | 100% | 42A>G;786T>C |
| 2 | human | 115290 | FBXO17 | F-box protein 17 | NM_148169.2 | 96.6% | 96.8% | 1_27del;69A>G;813T>C |
| 3 | human | 115290 | FBXO17 | F-box protein 17 | NR_104026.2 | 36.8% | (many diffs) | |
| 4 | mouse | 50760 | Fbxo17 | F-box protein 17 | NM_015796.2 | 81.1% | 83.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 900
- ORF length:
- 834
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 tnggcatggg cgcccggcta tcgcggcgac ggctgccggc ggacccgtcc ctggccctgg 121 acgcgctgcc cccggagctg ctggtgcagg tgctgagcca cgtgccgcca cgctccttgg 181 tcacgcgatg ccgcccagtg tgccgcgcct ggcgcgacat agtggacggg cccactgtgt 241 ggctgctgca gctggcccgc gaccgcagcg ccgagggccg cgcactctac gcagtggctc 301 aacgctgcct gcccagcaac gaagacaagg aggagttccc gctgtgcgcc ctggcgcgct 361 actgtctgcg cgcgcccttc ggccgcaatc tcatcttcaa ctcctgcgga gagcagggct 421 tcagaggctg ggaggtggag catggcggga acggctgggc catagaaaag aacctaacac 481 cggtgcctgg ggctccttcg cagaccTGCT TCGTGACCTC TTTCGAATGG TGCTCCAAGA 541 GGCAGCTTGT GGACCTGGTG ATGGAAGGGG TGTGGCAGGA GCTGCTGGAC AGCGCCCAGA 601 TTGAGATCTG TGTGGCTGAC TGGTGGGGCG CTCGAGAGAA CTGCGGCTGC GTCTACCAGC 661 TCCGGGTCCG CCTTCTGGAT GTGTATGAAA AGGAAGTGGT CAAGTTCTCA GCCTCACCTG 721 ACCCGGTCCT TCAGTGGACT GAGAGGGGCT GCCGACAGGT CTCCCACGTC TTCACCAACT 781 TTGGCAAGGG CATCCGCTAC GTATCTTTTG AGCAGTACGG GAGAGACGTG AGTTCCTGGG 841 TGGGGCACTA CGGCGCCCTT GTGACCCACT CCAGTGTGAG GGTCAGGATC CGTCTGTCCT 901 ACCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 961 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1021 TTTATATATC TTGTGGAAAG GACGAGAGGT ACCACATCTC CATCGTGGAA CGCGTTAAGT 1081 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt