Transcript: Human NM_024907.7

Homo sapiens F-box protein 17 (FBXO17), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
FBXO17 (115290)
Length:
2218
CDS:
175..1011

Additional Resources:

NCBI RefSeq record:
NM_024907.7
NBCI Gene record:
FBXO17 (115290)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024907.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022435 GCCGCAATCTCATCTTCAACT pLKO.1 491 CDS 100% 4.950 6.930 N FBXO17 n/a
2 TRCN0000342445 GCCGCAATCTCATCTTCAACT pLKO_005 491 CDS 100% 4.950 6.930 N FBXO17 n/a
3 TRCN0000022434 CATTTAGTTCATTTGCCTGCA pLKO.1 1544 3UTR 100% 2.160 1.512 N FBXO17 n/a
4 TRCN0000022438 GTGGTCAAGTTCTCAGCCTCA pLKO.1 805 CDS 100% 2.160 1.512 N FBXO17 n/a
5 TRCN0000342497 GTGGTCAAGTTCTCAGCCTCA pLKO_005 805 CDS 100% 2.160 1.512 N FBXO17 n/a
6 TRCN0000022436 GCAAGGGCATCCGCTACGTAT pLKO.1 893 CDS 100% 1.650 1.155 N FBXO17 n/a
7 TRCN0000342446 GCAAGGGCATCCGCTACGTAT pLKO_005 893 CDS 100% 1.650 1.155 N FBXO17 n/a
8 TRCN0000022437 GCCCAGCAACGAAGACAAGGA pLKO.1 420 CDS 100% 0.880 0.616 N FBXO17 n/a
9 TRCN0000342444 GCCCAGCAACGAAGACAAGGA pLKO_005 420 CDS 100% 0.880 0.616 N FBXO17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024907.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09415 pDONR223 100% 99.7% 100% None 42A>G;786T>C n/a
2 ccsbBroad304_09415 pLX_304 0% 99.7% 100% V5 42A>G;786T>C n/a
3 TRCN0000491792 GAGGTACCACATCTCCATCGTGGA pLX_317 47.3% 99.7% 100% V5 42A>G;786T>C n/a
Download CSV