Transcript: Human NR_104026.2

Homo sapiens F-box protein 17 (FBXO17), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
FBXO17 (115290)
Length:
2256
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_104026.2
NBCI Gene record:
FBXO17 (115290)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_104026.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022435 GCCGCAATCTCATCTTCAACT pLKO.1 491 3UTR 100% 4.950 6.930 N FBXO17 n/a
2 TRCN0000342445 GCCGCAATCTCATCTTCAACT pLKO_005 491 3UTR 100% 4.950 6.930 N FBXO17 n/a
3 TRCN0000022434 CATTTAGTTCATTTGCCTGCA pLKO.1 1582 3UTR 100% 2.160 1.512 N FBXO17 n/a
4 TRCN0000022438 GTGGTCAAGTTCTCAGCCTCA pLKO.1 843 3UTR 100% 2.160 1.512 N FBXO17 n/a
5 TRCN0000342497 GTGGTCAAGTTCTCAGCCTCA pLKO_005 843 3UTR 100% 2.160 1.512 N FBXO17 n/a
6 TRCN0000022436 GCAAGGGCATCCGCTACGTAT pLKO.1 931 3UTR 100% 1.650 1.155 N FBXO17 n/a
7 TRCN0000342446 GCAAGGGCATCCGCTACGTAT pLKO_005 931 3UTR 100% 1.650 1.155 N FBXO17 n/a
8 TRCN0000022437 GCCCAGCAACGAAGACAAGGA pLKO.1 420 3UTR 100% 0.880 0.616 N FBXO17 n/a
9 TRCN0000342444 GCCCAGCAACGAAGACAAGGA pLKO_005 420 3UTR 100% 0.880 0.616 N FBXO17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_104026.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09415 pDONR223 100% 36.8% None (many diffs) n/a
2 ccsbBroad304_09415 pLX_304 0% 36.8% V5 (many diffs) n/a
3 TRCN0000491792 GAGGTACCACATCTCCATCGTGGA pLX_317 47.3% 36.8% V5 (many diffs) n/a
Download CSV