Transcript: Human XR_001741200.1

PREDICTED: Homo sapiens dual adaptor of phosphotyrosine and 3-phosphoinositides 1 (DAPP1), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DAPP1 (27071)
Length:
3094
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001741200.1
NBCI Gene record:
DAPP1 (27071)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001741200.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002605 CAGAATTAGTTGTATAGGGTT pLKO.1 2018 3UTR 100% 2.640 3.696 N DAPP1 n/a
2 TRCN0000002603 TGTGCAAAGACCGGAGTAGAA pLKO.1 913 3UTR 100% 4.950 3.960 N DAPP1 n/a
3 TRCN0000355742 GATGACTTCTGCAGGATTTAT pLKO_005 1528 3UTR 100% 15.000 10.500 N DAPP1 n/a
4 TRCN0000355743 GATGAGTGGATCAAGATATTA pLKO_005 937 3UTR 100% 15.000 10.500 N DAPP1 n/a
5 TRCN0000355796 AGCTGTACAATTCGATTATTC pLKO_005 726 3UTR 100% 13.200 9.240 N DAPP1 n/a
6 TRCN0000002604 CGAGGAGAAGACTGATCACAA pLKO.1 1017 3UTR 100% 4.950 3.465 N DAPP1 n/a
7 TRCN0000002601 GTGAGGGCCAAAGATTCTGTT pLKO.1 304 3UTR 100% 4.950 3.465 N DAPP1 n/a
8 TRCN0000355744 TGCTGATTGGGACCCATATAC pLKO_005 1228 3UTR 100% 13.200 7.920 N DAPP1 n/a
9 TRCN0000002602 GCAGACAGGAAGAACAGAAGA pLKO.1 528 3UTR 100% 4.950 2.970 N DAPP1 n/a
10 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 2621 3UTR 100% 4.050 2.025 Y P3H4 n/a
11 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 2621 3UTR 100% 4.050 2.025 Y ORAI2 n/a
12 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 2621 3UTR 100% 4.050 2.025 Y P3H4 n/a
13 TRCN0000172586 GCCTGGCCAACATGATGAAAT pLKO.1 2650 3UTR 100% 13.200 6.600 Y SPIRE2 n/a
14 TRCN0000180546 GCCTGTAATCCCAGGACTTTA pLKO.1 2583 3UTR 100% 13.200 6.600 Y PRR11 n/a
15 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 2748 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001741200.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491823 CAATCCAGATACCGGCCCTCTAGG pLX_317 36% 27.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV