Construct: ORF TRCN0000491987
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF022033.2_s317c1
- DNA Barcode:
- GTACAACTGTTGCATTTAAGTCCG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- PDE1B (5153)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491987
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5153 | PDE1B | phosphodiesterase 1B | NM_000924.4 | 99.9% | 100% | 1476T>C |
| 2 | human | 5153 | PDE1B | phosphodiesterase 1B | NM_001165975.3 | 94.8% | 93.8% | (many diffs) |
| 3 | human | 5153 | PDE1B | phosphodiesterase 1B | XM_011538456.1 | 93.6% | 92.5% | (many diffs) |
| 4 | human | 5153 | PDE1B | phosphodiesterase 1B | XM_017019432.1 | 93.3% | 93% | (many diffs) |
| 5 | human | 5153 | PDE1B | phosphodiesterase 1B | NM_001288769.1 | 92.2% | 92.3% | 0_1ins123;1353T>C |
| 6 | human | 5153 | PDE1B | phosphodiesterase 1B | XM_017019433.1 | 92.2% | 92.3% | 0_1ins123;1353T>C |
| 7 | human | 5153 | PDE1B | phosphodiesterase 1B | NM_001288768.1 | 74.3% | 74.4% | 0_1ins411;1065T>C |
| 8 | human | 5153 | PDE1B | phosphodiesterase 1B | NM_001315534.2 | 74.3% | 74.4% | 0_1ins411;1065T>C |
| 9 | human | 5153 | PDE1B | phosphodiesterase 1B | NM_001315535.2 | 61.8% | 61.9% | 0_1ins612;864T>C |
| 10 | mouse | 18574 | Pde1b | phosphodiesterase 1B, Ca2+-... | NM_008800.2 | 90.6% | 95.8% | (many diffs) |
| 11 | mouse | 18574 | Pde1b | phosphodiesterase 1B, Ca2+-... | NM_001285890.1 | 86.1% | 89.9% | (many diffs) |
| 12 | mouse | 18574 | Pde1b | phosphodiesterase 1B, Ca2+-... | XM_006520588.3 | 85.9% | 89.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1677
- ORF length:
- 1608
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcaccat ggagctgtcc ccccgcagtc ctccggagat gctggaggag tcggattgcc 121 cgtcacccct ggagctgaag tcagccccca gcaagaagat gtggattaag cttcggtctc 181 tgctgcgcta catggtgaag cagttggaga atggggagat aaacattgag gagctgaaga 241 aaaatctgga gtacacagct tctctgctgg aagccgtcta catagatgag acacggcaaa 301 tcttggacac ggaggacgag ctgcaggagc tgcggtcaga tgccgtgcct tcggaggtgc 361 gggactggct ggcctccacc ttcacccagc aggcccgggc caaaggccgc cgagcagagg 421 agaagcccaa gttccgaagc attgtgcacg ctgtgcaggc tgggatcttc gtggaacgga 481 tgttccggag aacatacacc tctgtgggcc ccacttactc tactgcggtt ctcaactgtc 541 tcaagaacct ggatctctgg tgctttgatg tcttttcctt gaaccaggca gcagatgacc 601 atgccctgag gaccattgtt tttgagttgc tgactcggca taacctcatc agccgcttca 661 agattcccac tgtgtttttg atgagtttcc tggatgcctt ggagacaggc tatgggaagt 721 acaagaatcc ttaccacaac cagatccacg cagccgatgt tacccagaca gtccattgct 781 tcttgctccg cacagggatg gtgcactgcc tgtcggagat tgagctcctg gccatcatct 841 ttgctgcagc tatccatgat tatgagcaca cgggcactac caacagcttc cacatccaga 901 ccaagtcaga atgtgccatc gtgtacaatg atcgttcagt gctggagaat caccacatca 961 gctctgtttt ccgattgatg caggatgatg agatgaacat tttcatcaac ctcaccaagg 1021 atgagtttgt agaactccga gccctggtca ttgagatggt gttggccaca gacatgtcct 1081 gccatttcca gcaagtgaag accatgaaga cagccttgca acagctggag aggattgaca 1141 agcccaaggc cctgtctcta ctgctccatg ctgctgacat cagccaccca accaagcagt 1201 ggttggtcca cagccgttgg accaaggccc tcatggagga attcttccgt cagggtgaca 1261 aggaggcaga gttgggcctg cccttttctc cactctgtga ccgcacttcc actctagtgg 1321 cacagtctca gatagggttc atcgacTTCA TTGTGGAGCC CACATTCTCT GTGCTGACTG 1381 ACGTGGCAGA GAAGAGTGTT CAGCCCCTGG CGGATGAGGA CTCCAAGTCT AAAAACCAGC 1441 CCAGCTTTCA GTGGCGCCAG CCCTCTCTGG ATGTGGAAGT GGGAGACCCC AACCCTGATG 1501 TGGTCAGCTT TCGTTCCACC TGGGTCAAGC GCATTCAGGA GAACAAGCAG AAATGGAAGG 1561 AACGGGCAGC AAGTGGCATC ACCAACCAGA TGTCCATTGA CGAGCTGTCC CCCTGTGAAG 1621 AAGAGGCCCC CCCATCCCCT GCCGAAGATG AACACAACCA GAATGGGAAT CTGGATTAGG 1681 ACCCAGCTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1741 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1801 TTTATATATC TTGTGGAAAG GACGAGTACA ACTGTTGCAT TTAAGTCCGA CGCGTTAAGT 1861 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt