Transcript: Human NM_001315534.2

Homo sapiens phosphodiesterase 1B (PDE1B), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
PDE1B (5153)
Length:
2971
CDS:
375..1574

Additional Resources:

NCBI RefSeq record:
NM_001315534.2
NBCI Gene record:
PDE1B (5153)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001315534.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437800 GAGTTGCTGACTCGGCATAAC pLKO_005 519 CDS 100% 10.800 15.120 N PDE1B n/a
2 TRCN0000437218 AGATCCACGCAGCCGATGTTA pLKO_005 637 CDS 100% 5.625 7.875 N PDE1B n/a
3 TRCN0000048976 CAAGCGCATTCAGGAGAATAA pLKO.1 1421 CDS 100% 13.200 9.240 N PDE1B n/a
4 TRCN0000048973 GCTGCAGCTATCCATGATTAT pLKO.1 738 CDS 100% 13.200 9.240 N PDE1B n/a
5 TRCN0000432579 CATCCAGACCAAGTCAGAATG pLKO_005 788 CDS 100% 10.800 7.560 N PDE1B n/a
6 TRCN0000438231 CATGCCCTGAGGACCATTGTT pLKO_005 495 CDS 100% 5.625 3.938 N PDE1B n/a
7 TRCN0000048974 GCAGGATGATGAGATGAACAT pLKO.1 875 CDS 100% 4.950 3.465 N PDE1B n/a
8 TRCN0000115001 GCCTCCAAGTTTCTAAGCAAT pLKO.1 1952 3UTR 100% 4.950 3.465 N Pde1b n/a
9 TRCN0000115004 CCAGAATGGGAATCTGGATTA pLKO.1 1553 CDS 100% 1.080 0.648 N Pde1b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001315534.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489174 TCTCCCAGGCCTTAGTTAAAGTTC pLX_317 24% 80.5% 80.6% V5 (not translated due to prior stop codon) 0_1ins288;1065T>C n/a
2 TRCN0000491987 GTACAACTGTTGCATTTAAGTCCG pLX_317 21% 74.3% 74.4% V5 (not translated due to prior stop codon) 0_1ins411;1065T>C n/a
Download CSV