Transcript: Human XM_017019432.1

PREDICTED: Homo sapiens phosphodiesterase 1B (PDE1B), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PDE1B (5153)
Length:
2920
CDS:
18..1523

Additional Resources:

NCBI RefSeq record:
XM_017019432.1
NBCI Gene record:
PDE1B (5153)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019432.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437800 GAGTTGCTGACTCGGCATAAC pLKO_005 468 CDS 100% 10.800 15.120 N PDE1B n/a
2 TRCN0000437218 AGATCCACGCAGCCGATGTTA pLKO_005 586 CDS 100% 5.625 7.875 N PDE1B n/a
3 TRCN0000048976 CAAGCGCATTCAGGAGAATAA pLKO.1 1370 CDS 100% 13.200 9.240 N PDE1B n/a
4 TRCN0000048973 GCTGCAGCTATCCATGATTAT pLKO.1 687 CDS 100% 13.200 9.240 N PDE1B n/a
5 TRCN0000048975 CATAGATGAGACACGGCAAAT pLKO.1 125 CDS 100% 10.800 7.560 N PDE1B n/a
6 TRCN0000432579 CATCCAGACCAAGTCAGAATG pLKO_005 737 CDS 100% 10.800 7.560 N PDE1B n/a
7 TRCN0000438231 CATGCCCTGAGGACCATTGTT pLKO_005 444 CDS 100% 5.625 3.938 N PDE1B n/a
8 TRCN0000048974 GCAGGATGATGAGATGAACAT pLKO.1 824 CDS 100% 4.950 3.465 N PDE1B n/a
9 TRCN0000115001 GCCTCCAAGTTTCTAAGCAAT pLKO.1 1901 3UTR 100% 4.950 3.465 N Pde1b n/a
10 TRCN0000115004 CCAGAATGGGAATCTGGATTA pLKO.1 1502 CDS 100% 1.080 0.648 N Pde1b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019432.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489174 TCTCCCAGGCCTTAGTTAAAGTTC pLX_317 24% 98.7% 98.8% V5 (not translated due to prior stop codon) 1_18del;1371T>C n/a
2 TRCN0000491987 GTACAACTGTTGCATTTAAGTCCG pLX_317 21% 93.3% 93% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV