Construct: ORF TRCN0000492025
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020840.2_s317c1
- DNA Barcode:
- ATGGTTTAAAAGGTCCACGTGAGA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- ACKR3 (57007)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000492025
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 57007 | ACKR3 | atypical chemokine receptor 3 | NM_020311.3 | 99.9% | 100% | 162C>T |
| 2 | human | 57007 | ACKR3 | atypical chemokine receptor 3 | XM_005246097.3 | 99.9% | 100% | 162C>T |
| 3 | human | 57007 | ACKR3 | atypical chemokine receptor 3 | XM_005246098.3 | 99.9% | 100% | 162C>T |
| 4 | human | 57007 | ACKR3 | atypical chemokine receptor 3 | XM_017004516.2 | 99.9% | 100% | 162C>T |
| 5 | mouse | 12778 | Ackr3 | atypical chemokine receptor 3 | NM_001271607.1 | 88.5% | 92.8% | (many diffs) |
| 6 | mouse | 12778 | Ackr3 | atypical chemokine receptor 3 | NM_007722.4 | 88.5% | 92.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1158
- ORF length:
- 1086
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggatctg catctcttcg actactcaga gccagggaac ttctcggaca 121 tcagctggcc atgcaacagc agcgactgca tcgtggtgga cacggtgatg tgtcccaaca 181 tgcccaacaa aagcgtcctg ctctacacgc tctccttcat ttacattttc attttcgtca 241 tcggcatgat tgccaactcc gtggtggtct gggtgaatat ccaggccaag accacaggct 301 atgacacgca ctgctacatc ttgaacctgg ccattgccga cctgtgggtt gtcctcacca 361 tcccagtctg ggtggtcagt ctcgtgcagc acaaccagtg gcccatgggc gagctcacgt 421 gcaaagtcac acacctcatc ttctccatca acctcttcgg cagcattttc ttcctcacgt 481 gcatgagcgt ggaccgctac ctctccatca cctacttcac caacaccccc agcagcagga 541 agaagatggt acgccgtgtc gtctgcatcc tggtgtggct gctggccttc tgcgtgtctc 601 tgcctgacac ctactacctg aagaccgtca cgtctgcgtc caacaatgag acctactgcc 661 ggtccttcta ccccgagcac agcatcaagg agtggctgat cggcatggag ctggtctccg 721 ttgtcttggg ctttgccgtt cccttctcca ttatcgctgt cttctacttc ctgctggcca 781 gagccatctc ggcgtccagt gaccaggaga agcacagcag ccggaagatc atcttctccT 841 ACGTGGTGGT CTTCCTTGTC TGCTGGCTGC CCTACCACGT GGCGGTGCTG CTGGACATCT 901 TCTCCATCCT GCACTACATC CCTTTCACCT GCCGGCTGGA GCACGCCCTC TTCACGGCCC 961 TGCATGTCAC ACAGTGCCTG TCGCTGGTGC ACTGCTGCGT CAACCCTGTC CTCTACAGCT 1021 TCATCAATCG CAACTACAGG TACGAGCTGA TGAAGGCCTT CATCTTCAAG TACTCGGCCA 1081 AAACAGGGCT CACCAAGCTC ATCGATGCCT CCAGAGTCTC AGAGACGGAG TACTCTGCCT 1141 TGGAGCAGAG CACCAAATAG GACCCAGCTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1201 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1261 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAATGG TTTAAAAGGT 1321 CCACGTGAGA ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt