Construct: ORF TRCN0000492028
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019836.2_s317c1
- DNA Barcode:
- GACGGTAGGTTTTTAAAGGTTAAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- USP54 (159195)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000492028
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_005269582.2 | 45.5% | 45.5% | 1_2565del;3985_3999del;4740_4741insG |
2 | human | 159195 | USP54 | ubiquitin specific peptidas... | NM_001350995.2 | 45.3% | 45.3% | 1_2445del;3865_4020del;4761_4762insG |
3 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_024447852.1 | 45.3% | 45.3% | 1_2445del;3865_4020del;4761_4762insG |
4 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_024447851.1 | 44.4% | 44.4% | 1_2682del;4102_4116del;4857_4858insG |
5 | human | 159195 | USP54 | ubiquitin specific peptidas... | NM_001320437.2 | 44.3% | 44.3% | 1_2565del;3985_4125del;4866_4867insG |
6 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_017015783.1 | 44.2% | 44.2% | 1_2565del;3985_4140del;4881_4882insG |
7 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_017015784.1 | 44.2% | 44.2% | 1_2565del;3985_4140del;4881_4882insG |
8 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_017015782.2 | 43.7% | 43.7% | 1_2616del;4036_4191del;4932_4933insG |
9 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_011539368.2 | 43.6% | 43.6% | 1_2631del;4051_4206del;4947_4948insG |
10 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_024447850.1 | 43.5% | 43.5% | 1_2802del;4962_4963insG |
11 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_024447849.1 | 43.3% | 43.3% | 1_2802del;4222_4236del;4977_4978insG |
12 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_024447848.1 | 43.2% | 43.1% | 1_2682del;4102_4257del;4998_4999insG |
13 | human | 159195 | USP54 | ubiquitin specific peptidas... | NM_152586.3 | 42.7% | 42.7% | 1_2736del;4156_4311del;5052_5053insG |
14 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_017015774.1 | 42.7% | 42.7% | 1_2736del;4156_4311del;5052_5053insG |
15 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_017015775.1 | 42.7% | 42.7% | 1_2736del;4156_4311del;5052_5053insG |
16 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_017015777.1 | 42.7% | 42.7% | 1_2736del;4156_4311del;5052_5053insG |
17 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_024447847.1 | 42.7% | 42.7% | 1_2736del;4156_4311del;5052_5053insG |
18 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_024447846.1 | 42.3% | 42.3% | 1_2802del;4222_4362del;5103_5104insG |
19 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_024447832.1 | 42.1% | 42.1% | 1_2802del;4222_4377del;5118_5119insG |
20 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_024447833.1 | 42.1% | 42.1% | 1_2802del;4222_4377del;5118_5119insG |
21 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_024447834.1 | 42.1% | 42.1% | 1_2802del;4222_4377del;5118_5119insG |
22 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_024447835.1 | 42.1% | 42.1% | 1_2802del;4222_4377del;5118_5119insG |
23 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_024447836.1 | 42.1% | 42.1% | 1_2802del;4222_4377del;5118_5119insG |
24 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_024447837.1 | 42.1% | 42.1% | 1_2802del;4222_4377del;5118_5119insG |
25 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_024447838.1 | 42.1% | 42.1% | 1_2802del;4222_4377del;5118_5119insG |
26 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_024447839.1 | 42.1% | 42.1% | 1_2802del;4222_4377del;5118_5119insG |
27 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_024447840.1 | 42.1% | 42.1% | 1_2802del;4222_4377del;5118_5119insG |
28 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_024447841.1 | 42.1% | 42.1% | 1_2802del;4222_4377del;5118_5119insG |
29 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_024447842.1 | 42.1% | 42.1% | 1_2802del;4222_4377del;5118_5119insG |
30 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_024447843.1 | 42.1% | 42.1% | 1_2802del;4222_4377del;5118_5119insG |
31 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_024447844.1 | 42.1% | 42.1% | 1_2802del;4222_4377del;5118_5119insG |
32 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_024447845.1 | 42.1% | 42.1% | 1_2802del;4222_4377del;5118_5119insG |
33 | human | 159195 | USP54 | ubiquitin specific peptidas... | NR_135250.1 | 38.7% | 1_2135del;3555_3695del;4437_5569delinsG | |
34 | human | 159195 | USP54 | ubiquitin specific peptidas... | XR_001747048.1 | 37.6% | 1_2331del;3751_3906del;4648_5741delinsG | |
35 | human | 159195 | USP54 | ubiquitin specific peptidas... | XR_001747042.1 | 36.5% | 1_2502del;3922_4077del;4819_5912delinsG | |
36 | human | 159195 | USP54 | ubiquitin specific peptidas... | NR_146998.2 | 36% | 1_2728del;4148_4162del;4904_5997delinsG | |
37 | human | 159195 | USP54 | ubiquitin specific peptidas... | NR_146997.2 | 35.1% | 1_2728del;4148_4303del;5045_6138delinsG | |
38 | human | 159195 | USP54 | ubiquitin specific peptidas... | NR_135249.2 | 33.7% | 1_3132del;4552_4566del;5308_6401delinsG | |
39 | human | 159195 | USP54 | ubiquitin specific peptidas... | XR_001747041.2 | 31.6% | 1_3407del;4827_4982del;5724_6817delinsG | |
40 | human | 159195 | USP54 | ubiquitin specific peptidas... | XR_001747037.2 | 28.7% | 1_4093del;5513_5668del;6410_7503delinsG | |
41 | human | 159195 | USP54 | ubiquitin specific peptidas... | XR_001747046.1 | 27.7% | 1_4385del;5805_5960del;6702_7795delinsG | |
42 | human | 159195 | USP54 | ubiquitin specific peptidas... | XR_001747043.1 | 27.6% | 1_4556del;5976_5990del;6732_7825delinsG | |
43 | human | 159195 | USP54 | ubiquitin specific peptidas... | XR_001747035.1 | 26.8% | 1_4622del;6042_6197del;6939_8032delinsG | |
44 | human | 159195 | USP54 | ubiquitin specific peptidas... | XR_001747038.1 | 25.5% | 1_5055del;6475_6630del;7372_8465delinsG | |
45 | human | 159195 | USP54 | ubiquitin specific peptidas... | XR_001747047.1 | 24.2% | 1_5515del;6935_7075del;7817_8910delinsG | |
46 | human | 159195 | USP54 | ubiquitin specific peptidas... | XR_001747044.1 | 24.1% | 1_5686del;7847_8940delinsG | |
47 | human | 159195 | USP54 | ubiquitin specific peptidas... | XR_001747039.1 | 24.1% | 1_5686del;7106_7120del;7862_8955delinsG | |
48 | human | 159195 | USP54 | ubiquitin specific peptidas... | XR_002956962.1 | 24% | 1_5581del;7001_7156del;7898_8991delinsG | |
49 | human | 159195 | USP54 | ubiquitin specific peptidas... | XR_001747036.1 | 23.9% | 1_5752del;7172_7186del;7928_9021delinsG | |
50 | human | 159195 | USP54 | ubiquitin specific peptidas... | XR_002956959.1 | 23.5% | 1_5752del;7172_7327del;8069_9162delinsG | |
51 | human | 159195 | USP54 | ubiquitin specific peptidas... | XR_002956960.1 | 20.6% | 1_5752del;7386_7387ins527 | |
52 | human | 159195 | USP54 | ubiquitin specific peptidas... | XR_002956961.1 | 18% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 2232
- ORF length:
- 2163
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcaccat ggatacagag tttggggcca gttctttctt ccattcacct gcttcctgcc 121 atgagtcaca ctcatcacta tctccagagt catctgcccc acagcacagc tcccccagta 181 gatctgcctt gaagcttctg acttcggttg aagtagacaa cattgaaccc tctgcattcc 241 acaggcaagg tttacctaaa gcaccagggt ggactgagaa gaattctcat catagttggg 301 agccattgga tgccccagag ggtaagctgc aaggctctag gtgtgacaac agcagttgca 361 gcaagctccc tccacaagaa ggaagaggca ttgctcaaga acagctgttc caagaaaaga 421 aggatcctgc taacccctcc ccggtgatgc ctggaatagc cacctctgag aggggtgatg 481 aacacagcct aggctgtagt ccttcaaatt catcagctca gcccagcctt cccctgtata 541 gaacctgcca ccccataatg cctgttgctt cttcatttgt gcttcactgt cctgatcctg 601 tgcagaaaac taaccaatgc ctccaaggcc aaagcctcaa aacttcattg actttaaaag 661 tggacagagg cagtgaggag acctataggc cagagtttcc cagcacaaag gggcttgtcc 721 gttctctggc tgagcagttc cagaggatgc agggtgtctc catgagggat agtacaggtt 781 tcaaggatag aagtttgtca ggtagtctaa ggaagaactc ttccccttct gattctaagc 841 ctcctttctc acagggtcaa gagaaaggcc actggccatg ggcaaagcaa caatcctctc 901 tggagggtgg ggatagacca ctttcctggg aagagtccac tgaacattct tctcttgcct 961 taaactctgg gctgcctaat ggtgaaactt ctagcggagg acagcccagg ttggcagagc 1021 cagacatata ccaagagaag ctgtcccaag tgagagatgt taggtctaag gatctgggca 1081 gcagtactga cttggggact tccttgcctt tggattcctg ggtgaatatc acaaggttct 1141 gtgattctca gcttaagcat ggggcaccta ggccaggaat gaagtcctcc cctcatgatt 1201 cccatacgtg tgtaacctat ccagagagaa atcacatcct tttgcatcca cattggaacc 1261 aagacacaga gcaggagacc tcagaattgg agtctctgta tcaggccagt cttcaggctt 1321 ctcaagctgg ctgttctgga tgggggcagc aggataccgc ctggcaccca cttagccaaa 1381 caggctctgc agatggcatg gggaggaggt tgcactcagc ccatgatcct ggtctctcaa 1441 agacttcaac agcagaaatg gagcatggtc tccatgaagc cagaacagat tcatcaaacg 1501 tgaggaagcc tttggaaacc gggcaccgtt gttccagctc ctcttccctc cctgtcatcc 1561 atgacccttc tgtgtttctc ctcggtcccc aactctacct tccccaacca cagttcctgt 1621 ccccagatgt cctgatgccc accatggcag gggagcccaa tagactccca ggaacttcaa 1681 ggagtgtcca gcagtttctg gctatgtgtg acaggggtga aacttcccaa ggggccaagt 1741 acacaggaag gactttgaac taccagagcc tcccccatcg ctccagaaca gacaactcct 1801 gggcaccctg gtcagagacc aaccagcata ttgggaccag attcctgacT ACTCCAGGGT 1861 GCAATCCTCA ACTAACCTAC ACTGCCACAC TACCAGAAAG AAGCAAGGGC CTTCAGGTTC 1921 CTCACACTCA GTCCTGGAGT GATCTTTTCC ATTCACCCTC CCACCCTCCC ATTGTTCATC 1981 CTGTGTACCC ACCATCTAGC AGTCTTCATG TACCCCTGAG GTCAGCTTGG AATTCAGATC 2041 CTGTTCCAGG GTCCCGAACC CCTGGTCCTC GAAGAGTAGA TATGCCCCCA GATGATGACT 2101 GGAGGCAAAG CAGTTATGCC TCCCACTCTG GACACAGGAG AACAGTGGGA GAGGGGTTTC 2161 TGTTTGTTCT ATCAGATGCT CCCAGAAGAG AGCAGATCAG GGCTAGAGTC CTGCAGCACA 2221 GTCAATGGGA CCCAGCTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 2281 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 2341 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGAGACGGT AGGTTTTTAA AGGTTAATAC 2401 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt