Transcript: Human NM_178324.3

Homo sapiens serine palmitoyltransferase long chain base subunit 1 (SPTLC1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
SPTLC1 (10558)
Length:
976
CDS:
44..475

Additional Resources:

NCBI RefSeq record:
NM_178324.3
NBCI Gene record:
SPTLC1 (10558)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_178324.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035013 GCAGCAGCTTTAGCATCTCTA pLKO.1 398 CDS 100% 4.950 3.465 N SPTLC1 n/a
2 TRCN0000299785 GCAGCAGCTTTAGCATCTCTA pLKO_005 398 CDS 100% 4.950 3.465 N SPTLC1 n/a
3 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 682 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178324.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07636 pDONR223 100% 99.7% 99.3% None 418G>C n/a
2 ccsbBroad304_07636 pLX_304 0% 99.7% 99.3% V5 418G>C n/a
3 TRCN0000473536 CGACTAAACCGTAATGTCCTCCCG pLX_317 100% 99.7% 99.3% V5 418G>C n/a
4 ccsbBroadEn_11522 pDONR223 100% 27.8% 27.6% None 429_429delAins1111 n/a
5 ccsbBroad304_11522 pLX_304 0% 27.8% 27.6% V5 429_429delAins1111 n/a
6 TRCN0000492268 TCTTTGGCAGCTGACGATCTCACA pLX_317 23.9% 27.8% 27.6% V5 429_429delAins1111 n/a
Download CSV