Transcript: Mouse XM_006516927.1

PREDICTED: Mus musculus serine palmitoyltransferase, long chain base subunit 1 (Sptlc1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sptlc1 (268656)
Length:
1754
CDS:
69..878

Additional Resources:

NCBI RefSeq record:
XM_006516927.1
NBCI Gene record:
Sptlc1 (268656)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516927.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103401 CGAGGGTTCTATGGCACATTT pLKO.1 474 CDS 100% 13.200 18.480 N Sptlc1 n/a
2 TRCN0000295624 GACCGAAGAAGCCATCATTTA pLKO_005 539 CDS 100% 13.200 9.240 N Sptlc1 n/a
3 TRCN0000103402 CCCTGCTCTCAACTACAACAT pLKO.1 299 CDS 100% 4.950 2.970 N Sptlc1 n/a
4 TRCN0000288288 CCCTGCTCTCAACTACAACAT pLKO_005 299 CDS 100% 4.950 2.970 N Sptlc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516927.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07636 pDONR223 100% 44.5% 47.2% None (many diffs) n/a
2 ccsbBroad304_07636 pLX_304 0% 44.5% 47.2% V5 (many diffs) n/a
3 TRCN0000473536 CGACTAAACCGTAATGTCCTCCCG pLX_317 100% 44.5% 47.2% V5 (many diffs) n/a
4 ccsbBroadEn_11522 pDONR223 100% 44.5% 47.1% None (many diffs) n/a
5 ccsbBroad304_11522 pLX_304 0% 44.5% 47.1% V5 (many diffs) n/a
6 TRCN0000492268 TCTTTGGCAGCTGACGATCTCACA pLX_317 23.9% 44.5% 47.1% V5 (many diffs) n/a
Download CSV