Transcript: Human NR_146649.2

Homo sapiens antizyme inhibitor 2 (AZIN2), transcript variant 14, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
AZIN2 (113451)
Length:
5073
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_146649.2
NBCI Gene record:
AZIN2 (113451)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_146649.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000344902 GCAAATTGCACAGATCAAATA pLKO_005 680 3UTR 100% 13.200 9.240 N AZIN2 n/a
2 TRCN0000078516 ACCATCGTGTACCACCTTGAT pLKO.1 1320 3UTR 100% 4.950 3.465 N AZIN2 n/a
3 TRCN0000333782 ACCATCGTGTACCACCTTGAT pLKO_005 1320 3UTR 100% 4.950 3.465 N AZIN2 n/a
4 TRCN0000078517 CTGTAAGCAAATTGCACAGAT pLKO.1 674 3UTR 100% 4.950 3.465 N AZIN2 n/a
5 TRCN0000078515 GCCATAGTGAGGAAGCACTTT pLKO.1 474 3UTR 100% 4.950 3.465 N AZIN2 n/a
6 TRCN0000078513 GCCTCAGAGATGCATCTGGGA pLKO.1 1798 3UTR 100% 0.220 0.154 N AZIN2 n/a
7 TRCN0000333863 GCCTCAGAGATGCATCTGGGA pLKO_005 1798 3UTR 100% 0.220 0.154 N AZIN2 n/a
8 TRCN0000078514 GCTGAGCTTTGACAATGAGAT pLKO.1 725 3UTR 100% 4.950 2.970 N AZIN2 n/a
9 TRCN0000333862 GCTGAGCTTTGACAATGAGAT pLKO_005 725 3UTR 100% 4.950 2.970 N AZIN2 n/a
10 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 2882 3UTR 100% 4.950 2.475 Y CFLAR n/a
11 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 2882 3UTR 100% 4.950 2.475 Y C19orf31 n/a
12 TRCN0000161892 GCCTGTAATTCCAGCTACTTA pLKO.1 3017 3UTR 100% 5.625 2.813 Y GPN2 n/a
13 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 2880 3UTR 100% 4.950 2.475 Y ERN2 n/a
14 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 2880 3UTR 100% 4.950 2.475 Y P3H4 n/a
15 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 2880 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_146649.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04649 pDONR223 100% 27.2% None (many diffs) n/a
2 ccsbBroad304_04649 pLX_304 0% 27.2% V5 (many diffs) n/a
3 TRCN0000492272 CACACAGCCCCATTCCCGTTGGGC pLX_317 28.5% 27.2% V5 (many diffs) n/a
Download CSV