Construct: ORF TRCN0000492317
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017108.1_s317c1
- Derived from:
- ccsbBroadEn_09690
- DNA Barcode:
- ACCGATATCTAGACTAGAAGAGAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- JAKMIP1 (152789)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000492317
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 152789 | JAKMIP1 | janus kinase and microtubul... | NM_001306133.1 | 99.8% | 99.8% | 339G>A;489G>T;525T>C |
| 2 | human | 152789 | JAKMIP1 | janus kinase and microtubul... | NM_144720.4 | 99.8% | 99.8% | 339G>A;489G>T;525T>C |
| 3 | human | 152789 | JAKMIP1 | janus kinase and microtubul... | XM_024453911.1 | 99.8% | 99.8% | 339G>A;489G>T;525T>C |
| 4 | human | 152789 | JAKMIP1 | janus kinase and microtubul... | XM_017007796.1 | 89.8% | 86.1% | (many diffs) |
| 5 | human | 152789 | JAKMIP1 | janus kinase and microtubul... | XM_017007795.1 | 75% | 73.6% | (many diffs) |
| 6 | human | 152789 | JAKMIP1 | janus kinase and microtubul... | XM_017007794.1 | 74.4% | 73% | (many diffs) |
| 7 | human | 152789 | JAKMIP1 | janus kinase and microtubul... | NM_001099433.2 | 74.1% | 72.8% | (many diffs) |
| 8 | human | 152789 | JAKMIP1 | janus kinase and microtubul... | XM_017007793.1 | 74.1% | 72.8% | (many diffs) |
| 9 | human | 152789 | JAKMIP1 | janus kinase and microtubul... | XM_017007792.1 | 73.8% | 72.4% | (many diffs) |
| 10 | human | 152789 | JAKMIP1 | janus kinase and microtubul... | NM_001306134.1 | 73.6% | 73.6% | 128_129ins495 |
| 11 | human | 152789 | JAKMIP1 | janus kinase and microtubul... | XM_011513400.2 | 73.6% | 73.6% | 128_129ins495 |
| 12 | human | 152789 | JAKMIP1 | janus kinase and microtubul... | XM_017007791.1 | 73.4% | 72.1% | (many diffs) |
| 13 | human | 152789 | JAKMIP1 | janus kinase and microtubul... | XM_017007788.1 | 73.1% | 71.7% | (many diffs) |
| 14 | human | 152789 | JAKMIP1 | janus kinase and microtubul... | XM_017007789.1 | 73.1% | 71.7% | (many diffs) |
| 15 | human | 152789 | JAKMIP1 | janus kinase and microtubul... | XM_017007790.1 | 73.1% | 71.7% | (many diffs) |
| 16 | human | 152789 | JAKMIP1 | janus kinase and microtubul... | XM_017007799.1 | 54.4% | 53% | (many diffs) |
| 17 | human | 152789 | JAKMIP1 | janus kinase and microtubul... | XM_017007797.1 | 53.7% | 52.3% | (many diffs) |
| 18 | human | 152789 | JAKMIP1 | janus kinase and microtubul... | XM_017007798.1 | 53.7% | 52.3% | (many diffs) |
| 19 | mouse | 76071 | Jakmip1 | janus kinase and microtubul... | NM_178394.4 | 87.9% | 95.5% | (many diffs) |
| 20 | mouse | 76071 | Jakmip1 | janus kinase and microtubul... | XM_017321139.1 | 87.9% | 95.5% | (many diffs) |
| 21 | mouse | 76071 | Jakmip1 | janus kinase and microtubul... | XM_011240791.2 | 66.5% | 71.3% | (many diffs) |
| 22 | mouse | 76071 | Jakmip1 | janus kinase and microtubul... | NM_001347348.1 | 64.9% | 68% | (many diffs) |
| 23 | mouse | 76071 | Jakmip1 | janus kinase and microtubul... | XM_006504174.3 | 64.9% | 68% | (many diffs) |
| 24 | mouse | 76071 | Jakmip1 | janus kinase and microtubul... | XM_011240790.2 | 64.3% | 67.2% | (many diffs) |
| 25 | mouse | 76071 | Jakmip1 | janus kinase and microtubul... | XM_011240789.2 | 64% | 67% | (many diffs) |
| 26 | mouse | 76071 | Jakmip1 | janus kinase and microtubul... | XM_011240784.2 | 63.7% | 66.7% | (many diffs) |
| 27 | mouse | 76071 | Jakmip1 | janus kinase and microtubul... | XM_011240785.2 | 63.7% | 66.7% | (many diffs) |
| 28 | mouse | 76071 | Jakmip1 | janus kinase and microtubul... | XM_011240786.2 | 63.7% | 66.7% | (many diffs) |
| 29 | mouse | 76071 | Jakmip1 | janus kinase and microtubul... | XM_011240787.2 | 63.7% | 66.7% | (many diffs) |
| 30 | mouse | 76071 | Jakmip1 | janus kinase and microtubul... | XM_011240788.2 | 63.7% | 66.7% | (many diffs) |
| 31 | mouse | 76071 | Jakmip1 | janus kinase and microtubul... | XM_017321137.1 | 63.7% | 66.7% | (many diffs) |
| 32 | mouse | 76071 | Jakmip1 | janus kinase and microtubul... | XM_017321138.1 | 63.7% | 66.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1944
- ORF length:
- 1878
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc gaagaaaggc cggagcaagg gcgagaagcc cgagatggag acggacgcgg 121 tgcagatggc caacgaggag ctgcgggcca agctgaccag cattcagatc gagttccagc 181 aggaaaaaag caaggtgggc aaactgcgcg agcggctgca ggaggcgaag ctggagcgcg 241 agcaggagca gcgacggcac acggcctaca tttcggagct caaggccaag ctgcatgagg 301 agaagaccaa ggagctgcag gcgctgcgcg aggggctcat ccggcagcac gagcaggagg 361 cggcgcgcac cgccaagatc aaggagggcg agctgcagcg gctacaggcc acgctgaacg 421 tgctgcgcga cggcgcggcc gacaaggtca agacggcgct gctgaccgag gcgcgcgagg 481 aggcgcgcag ggccttcgat ggagagcgcc tgcggctgca gcaggagatc ctggagctca 541 aggcagcgcg caatcaggca gaggaggcgc tcagtaactg catgcaggcc gacaagacca 601 aggcagccga cctgcgtgcc gcctaccagg cgcaccaaga cgaggtgcac cgcatcaagc 661 gcgagtgcga gcgcgacatc cgcaggctga tggatgagat caaagggaaa gaccgtgtga 721 ttctggcctt ggagaaggaa cttggcgtgc aggctgggca gacccagaag ctgcttctgc 781 agaaagaggc tttggatgag cagctggttc aggtcaagga ggccgagcgg caccacagta 841 gtccaaagag agagctcccg cccgggatcg gggacatggt ggagctcatg ggcgtccagg 901 atcaacatat ggacgagcga gatgtgaggc gatttcaact aaaaattgct gaactgaatt 961 cagtgatacg gaagctggaa gacagaaata cgctgttggc agatgagagg aatgaactgc 1021 tgaaacgctc acgagagacc gaggttcagc tgaagcccct ggtggagaag aacaagcgga 1081 tgaacaagaa gaatgaggat ctgttgcaga gtatccagag gatggaggag aaaatcaaga 1141 acctcacgcg ggaaaacgtg gaaatgaaag aaaagctgtc agcgcaggcg tctctgaagc 1201 ggcatacctc cttgaatgac ctcagcctga cgagggatga gcaggagatc gagttcctga 1261 ggctgcaggt gctggagcag cagcacgtca ttgacgacct ctcactggag agagaacggc 1321 tgttgcgctc caaaaggcat cgagggaaaa gtctgaaacc gcccaagaag catgttgtgg 1381 agacattttt tggatttgat gaggagtctg tggactcaga aacgttgtcc gaaacatcct 1441 acaacacaga caggacagac aggaccccag ccacgcccga agaagacttg gacgatgcca 1501 cagcccgaga ggaggctgac ctgcgcttct gccagctgac ccgggagtac caggccctgc 1561 aacgcgccta cgccctgctc caggagcagg tgggaggcac gctggacgct gagagggagg 1621 cccggactcg ggagcagcta caagctgatc tgctgaggtg tcaggccaaa atcgaagatt 1681 tggagaagtt actggttgag aagggacagg attccaagtg ggttgaagag aagcagctgc 1741 tcatcagaac aaaccaagac ttgctggaaa agatttacag actggaaatg gaagagaacc 1801 agctgaagaa tgaaatgcaa gacgccaagg atcagaacga gctgttagaa ttcagagtgc 1861 TAGAACTCGA AGTAAGAGAC TCTATCTGTT GTAAACTCTC AAACGGAGCA GACATTCTCT 1921 TTGAACCCAA ACTGAAATTC ATGTACCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1981 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 2041 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAA CCGATATCTA 2101 GACTAGAAGA GACACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 2161 att