Transcript: Mouse XM_011240791.2

PREDICTED: Mus musculus janus kinase and microtubule interacting protein 1 (Jakmip1), transcript variant X12, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Jakmip1 (76071)
Length:
4598
CDS:
1784..4219

Additional Resources:

NCBI RefSeq record:
XM_011240791.2
NBCI Gene record:
Jakmip1 (76071)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240791.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247947 GAACCAGCTAAAGAGCGAAAT pLKO_005 3514 CDS 100% 10.800 15.120 N Jakmip1 n/a
2 TRCN0000247948 GAGCGAGATGTGAGGCGATTT pLKO_005 2633 CDS 100% 10.800 15.120 N Jakmip1 n/a
3 TRCN0000257685 GGGTGGCCAGGATCAACATAT pLKO_005 2608 CDS 100% 13.200 9.240 N Jakmip1 n/a
4 TRCN0000164196 CGAGATGTGAGGCGATTTCAA pLKO.1 2636 CDS 100% 5.625 3.938 N JAKMIP1 n/a
5 TRCN0000161083 GAAGCATGTTGTGGAGACATT pLKO.1 3085 CDS 100% 4.950 2.970 N JAKMIP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240791.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09690 pDONR223 100% 66.5% 71.3% None (many diffs) n/a
2 ccsbBroad304_09690 pLX_304 0% 66.5% 71.3% V5 (many diffs) n/a
3 TRCN0000492317 ACCGATATCTAGACTAGAAGAGAC pLX_317 4.9% 66.5% 71.3% V5 (many diffs) n/a
Download CSV