Transcript: Human XM_017007793.1

PREDICTED: Homo sapiens janus kinase and microtubule interacting protein 1 (JAKMIP1), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
JAKMIP1 (152789)
Length:
3060
CDS:
451..2946

Additional Resources:

NCBI RefSeq record:
XM_017007793.1
NBCI Gene record:
JAKMIP1 (152789)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007793.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247948 GAGCGAGATGTGAGGCGATTT pLKO_005 1300 CDS 100% 10.800 15.120 N Jakmip1 n/a
2 TRCN0000161225 GATCAGAACGAGCTGTTAGAA pLKO.1 2215 CDS 100% 5.625 7.875 N JAKMIP1 n/a
3 TRCN0000164196 CGAGATGTGAGGCGATTTCAA pLKO.1 1303 CDS 100% 5.625 3.938 N JAKMIP1 n/a
4 TRCN0000164441 CAAAGGGAAAGACCGTGTGAT pLKO.1 1086 CDS 100% 4.950 3.465 N JAKMIP1 n/a
5 TRCN0000164506 CAAGCTGACCAGCATTCAGAT pLKO.1 534 CDS 100% 4.950 3.465 N JAKMIP1 n/a
6 TRCN0000162228 CAGACTGGAAATGGAAGAGAA pLKO.1 2163 CDS 100% 4.950 3.465 N JAKMIP1 n/a
7 TRCN0000161083 GAAGCATGTTGTGGAGACATT pLKO.1 1752 CDS 100% 4.950 3.465 N JAKMIP1 n/a
8 TRCN0000160858 GCGGATGAACAAGAAGAATGA pLKO.1 1461 CDS 100% 4.950 3.465 N JAKMIP1 n/a
9 TRCN0000164442 CTGCAGAAAGAGGCTTTGGAT pLKO.1 1162 CDS 100% 3.000 2.100 N JAKMIP1 n/a
10 TRCN0000162026 GAATGAAATGCAAGACGCCAA pLKO.1 2193 CDS 100% 2.160 1.512 N JAKMIP1 n/a
11 TRCN0000163745 GCAGCTGCTCATCAGAACAAA pLKO.1 2118 CDS 100% 5.625 3.375 N JAKMIP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007793.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09690 pDONR223 100% 74.1% 72.8% None (many diffs) n/a
2 ccsbBroad304_09690 pLX_304 0% 74.1% 72.8% V5 (many diffs) n/a
3 TRCN0000492317 ACCGATATCTAGACTAGAAGAGAC pLX_317 4.9% 74.1% 72.8% V5 (many diffs) n/a
Download CSV