Construct: ORF TRCN0000492322
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021409.2_s317c1
- DNA Barcode:
- TACACAATCAATTACGAAATACCT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- PAK1 (5058)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000492322
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 5058 | PAK1 | p21 (RAC1) activated kinase 1 | NM_002576.4 | 82.3% | 82.3% | 598_885del |
2 | human | 5058 | PAK1 | p21 (RAC1) activated kinase 1 | XM_017017846.1 | 82.3% | 82.3% | 598_885del |
3 | human | 5058 | PAK1 | p21 (RAC1) activated kinase 1 | XM_017017847.2 | 82.3% | 82.3% | 598_885del |
4 | human | 5058 | PAK1 | p21 (RAC1) activated kinase 1 | XM_017017848.1 | 82.3% | 82.3% | 598_885del |
5 | human | 5058 | PAK1 | p21 (RAC1) activated kinase 1 | XM_017017849.1 | 82.3% | 82.3% | 598_885del |
6 | human | 5058 | PAK1 | p21 (RAC1) activated kinase 1 | XM_017017850.1 | 82.3% | 82.3% | 598_885del |
7 | human | 5058 | PAK1 | p21 (RAC1) activated kinase 1 | XM_024448560.1 | 82.3% | 82.3% | 598_885del |
8 | human | 5058 | PAK1 | p21 (RAC1) activated kinase 1 | XM_024448561.1 | 82.3% | 82.3% | 598_885del |
9 | human | 5058 | PAK1 | p21 (RAC1) activated kinase 1 | XM_024448562.1 | 82.3% | 82.3% | 598_885del |
10 | human | 5058 | PAK1 | p21 (RAC1) activated kinase 1 | XM_024448563.1 | 82.3% | 82.3% | 598_885del |
11 | human | 5058 | PAK1 | p21 (RAC1) activated kinase 1 | XM_024448564.1 | 82.3% | 82.3% | 598_885del |
12 | human | 5058 | PAK1 | p21 (RAC1) activated kinase 1 | NM_001128620.1 | 78.5% | 77% | 598_885del;1551_1599del;1659_1660ins25 |
13 | human | 5058 | PAK1 | p21 (RAC1) activated kinase 1 | XM_011545080.3 | 78.5% | 77% | 598_885del;1551_1599del;1659_1660ins25 |
14 | human | 5058 | PAK1 | p21 (RAC1) activated kinase 1 | XM_011545081.2 | 78.5% | 77% | 598_885del;1551_1599del;1659_1660ins25 |
15 | human | 5058 | PAK1 | p21 (RAC1) activated kinase 1 | XM_011545082.2 | 78.5% | 77% | 598_885del;1551_1599del;1659_1660ins25 |
16 | human | 5058 | PAK1 | p21 (RAC1) activated kinase 1 | XM_011545083.2 | 78.5% | 77% | 598_885del;1551_1599del;1659_1660ins25 |
17 | human | 5058 | PAK1 | p21 (RAC1) activated kinase 1 | XM_011545084.3 | 78.5% | 77% | 598_885del;1551_1599del;1659_1660ins25 |
18 | human | 5058 | PAK1 | p21 (RAC1) activated kinase 1 | XM_024448557.1 | 78.5% | 77% | 598_885del;1551_1599del;1659_1660ins25 |
19 | human | 5058 | PAK1 | p21 (RAC1) activated kinase 1 | XM_024448558.1 | 78.5% | 77% | 598_885del;1551_1599del;1659_1660ins25 |
20 | human | 5058 | PAK1 | p21 (RAC1) activated kinase 1 | XM_024448559.1 | 78.5% | 77% | 598_885del;1551_1599del;1659_1660ins25 |
21 | mouse | 18479 | Pak1 | p21 protein (Cdc42/Rac)-act... | NM_011035.2 | 75.9% | 81.4% | (many diffs) |
22 | mouse | 18479 | Pak1 | p21 protein (Cdc42/Rac)-act... | XM_017322028.1 | 75.9% | 81.4% | (many diffs) |
23 | mouse | 18479 | Pak1 | p21 protein (Cdc42/Rac)-act... | XM_006507434.1 | 74.8% | 80.2% | (many diffs) |
24 | mouse | 18479 | Pak1 | p21 protein (Cdc42/Rac)-act... | XM_006507436.3 | 74.8% | 80.2% | (many diffs) |
25 | mouse | 18479 | Pak1 | p21 protein (Cdc42/Rac)-act... | XM_006507437.2 | 74.8% | 80.2% | (many diffs) |
26 | mouse | 18479 | Pak1 | p21 protein (Cdc42/Rac)-act... | XM_011241694.1 | 74.8% | 80.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 96
- ORF end:
- 1443
- ORF length:
- 1347
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaatccg 61 cggccgcccc cttcaccgga tccctggtgg tgacaatgtc aaataacggc ctagacattc 121 aagacaaacc cccagcccct ccgatgagaa ataccagcac tatgattgga gccggcagca 181 aagatgctgg aaccctaaac catggttcta aacctctgcc tccaaaccca gaggagaaga 241 aaaagaagga ccgattttac cgatccattt tacctggaga taaaacaaat aaaaagaaag 301 agaaagagcg gccagagatt tctctccctt cagattttga acacacaatt catgtcggtt 361 ttgatgctgt cacaggggag tttacgggaa tgccagagca gtgggcccgc ttgcttcaga 421 catcaaatat cactaagtcg gagcagaaga aaaacccgca ggctgttctg gatgtgttgg 481 agttttacaa ctcgaagaag acatccaaca gccagaaata catgagcttt acagataagt 541 cagctgagga ttacaattct tctaatgcct tgaatgtgaa ggctgtgtct gagactcctg 601 cagtgccacc agtttcagaa gatgaggatg atgatgatga tgatgctacc ccaccaccag 661 tgattgctcc acgcccagag cacacaaaat ctgtggccat taagcagatg aatcttcagc 721 agcagcccaa gaaagagctg attattaatg agatcctggt catgagggaa aacaagaacc 781 caaacattgt gaattacttg gacagttacc tcgtgggaga tgagctgtgg gttgttatgg 841 aatacttggc tggaggctcc ttgacagatg tggtgacaga aacttgcatg gatgaaggcc 901 aaattgcagc tgtgtgccgt gagtgtctgc aggctctgga gttcttgcat tcgaaccagg 961 tcattcacag agacatcaag agtgacaata ttctgttggg aatggatggc tctgtcaagc 1021 taactgactt tGGATTCTGT GCACAGATAA CCCCAGAGCA GAGCAAACGG AGCACCATGG 1081 TAGGAACCCC ATACTGGATG GCACCAGAGG TTGTGACACG AAAGGCCTAT GGGCCCAAGG 1141 TTGACATCTG GTCCCTGGGC ATCATGGCCA TCGAAATGAT TGAAGGGGAG CCTCCATACC 1201 TCAATGAAAA CCCTCTGAGA GCCTTGTACC TCATTGCCAC CAATGGGACC CCAGAACTTC 1261 AGAACCCAGA GAAGCTGTCA GCTATCTTCC GGGACTTTCT GAACCGCTGT CTCGAGATGG 1321 ATGTGGAGAA GAGAGGTTCA GCTAAAGAGC TGCTACAGCA TCAATTCCTG AAGATTGCCA 1381 AGCCCCTCTC CAGCCTCACT CCACTGATTG CTGCAGCTAA GGAGGCAACA AAGAACAATC 1441 ACTAAAAGGG TGGGCGCGCC GACCCAGCTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1501 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1561 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGATACA CAATCAATTA 1621 CGAAATACCT ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt