Transcript: Mouse XM_006507436.3

PREDICTED: Mus musculus p21 protein (Cdc42/Rac)-activated kinase 1 (Pak1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pak1 (18479)
Length:
3010
CDS:
153..1811

Additional Resources:

NCBI RefSeq record:
XM_006507436.3
NBCI Gene record:
Pak1 (18479)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006507436.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025256 CCGAAGAAAGAGCTGATTATT pLKO.1 1092 CDS 100% 15.000 12.000 N Pak1 n/a
2 TRCN0000433563 GTTTGATAGCATTATCGATTT pLKO_005 2158 3UTR 100% 10.800 8.640 N Pak1 n/a
3 TRCN0000417541 AGTCAGCTGAAGATTATAATT pLKO_005 595 CDS 100% 15.000 10.500 N Pak1 n/a
4 TRCN0000423197 ACATCAAGAGTGACAATATTC pLKO_005 1339 CDS 100% 13.200 9.240 N Pak1 n/a
5 TRCN0000423643 GTGCTTCAGGCACAGTGTATA pLKO_005 1009 CDS 100% 13.200 9.240 N Pak1 n/a
6 TRCN0000417442 ACCATGGTGGGAACTCCATAT pLKO_005 1440 CDS 100% 10.800 7.560 N Pak1 n/a
7 TRCN0000434705 ACTCTAAGAAGACCTCCAATA pLKO_005 547 CDS 100% 10.800 7.560 N Pak1 n/a
8 TRCN0000025258 GCTGTGGGTTGTTATGGAATA pLKO.1 1190 CDS 100% 10.800 7.560 N Pak1 n/a
9 TRCN0000025254 CCCAGAGAAGTTGTCAGCTAT pLKO.1 1631 CDS 100% 4.950 3.465 N Pak1 n/a
10 TRCN0000002227 CTTCTCCCATTTCCTGATCTA pLKO.1 1908 3UTR 100% 4.950 2.970 N PAK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006507436.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01144 pDONR223 100% 90.8% 97.6% None (many diffs) n/a
2 ccsbBroad304_01144 pLX_304 31.1% 90.8% 97.6% V5 (many diffs) n/a
3 ccsbBroadEn_14726 pDONR223 84.3% 90.1% 39.6% None (many diffs) n/a
4 TRCN0000488535 ATAGGCAGGATTGATTGGACAGGA pLX_317 18.3% 88.2% 92.1% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489311 GAGCCAGCTGAAAACATACTTGAC pLX_317 18.9% 87% 92.3% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000492322 TACACAATCAATTACGAAATACCT pLX_317 31% 74.8% 80.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV