Transcript: Human XM_024448561.1

PREDICTED: Homo sapiens p21 (RAC1) activated kinase 1 (PAK1), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PAK1 (5058)
Length:
3169
CDS:
275..1912

Additional Resources:

NCBI RefSeq record:
XM_024448561.1
NBCI Gene record:
PAK1 (5058)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448561.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195500 CCCTAAACCATGGTTCTAAAC pLKO.1 372 CDS 100% 10.800 15.120 N PAK1 n/a
2 TRCN0000352635 CCCTAAACCATGGTTCTAAAC pLKO_005 372 CDS 100% 10.800 15.120 N PAK1 n/a
3 TRCN0000199394 CCAGAGGTTGTGACACGAAAG pLKO.1 1571 CDS 100% 6.000 8.400 N PAK1 n/a
4 TRCN0000197238 GCATTCGAACCAGGTCATTCA pLKO.1 1414 CDS 100% 4.950 6.930 N PAK1 n/a
5 TRCN0000342524 GCATTCGAACCAGGTCATTCA pLKO_005 1414 CDS 100% 4.950 6.930 N PAK1 n/a
6 TRCN0000002226 GCGATCCTAAGAAGAAATATA pLKO.1 1065 CDS 100% 15.000 12.000 N PAK1 n/a
7 TRCN0000342522 GCGATCCTAAGAAGAAATATA pLKO_005 1065 CDS 100% 15.000 12.000 N PAK1 n/a
8 TRCN0000195636 CATGGGAGAACAACCACATTT pLKO.1 2464 3UTR 100% 13.200 10.560 N PAK1 n/a
9 TRCN0000197010 GAGCTGCTACAGCATCAATTC pLKO.1 1814 CDS 100% 10.800 8.640 N PAK1 n/a
10 TRCN0000002224 CCAAGAAAGAGCTGATTATTA pLKO.1 1194 CDS 100% 15.000 10.500 N PAK1 n/a
11 TRCN0000342468 CCAAGAAAGAGCTGATTATTA pLKO_005 1194 CDS 100% 15.000 10.500 N PAK1 n/a
12 TRCN0000423197 ACATCAAGAGTGACAATATTC pLKO_005 1440 CDS 100% 13.200 9.240 N Pak1 n/a
13 TRCN0000002225 CGATGAGAAATACCAGCACTA pLKO.1 321 CDS 100% 4.050 2.835 N PAK1 n/a
14 TRCN0000025258 GCTGTGGGTTGTTATGGAATA pLKO.1 1291 CDS 100% 10.800 6.480 N Pak1 n/a
15 TRCN0000002227 CTTCTCCCATTTCCTGATCTA pLKO.1 2010 3UTR 100% 4.950 2.970 N PAK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448561.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01144 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01144 pLX_304 31.1% 100% 100% V5 n/a
3 ccsbBroadEn_14726 pDONR223 84.3% 99% 41.1% None (many diffs) n/a
4 ccsbBroad304_14726 pLX_304 51.6% 62.4% 38.5% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000488535 ATAGGCAGGATTGATTGGACAGGA pLX_317 18.3% 97% 94.4% V5 (not translated due to prior stop codon) 1550_1551ins49 n/a
6 TRCN0000489311 GAGCCAGCTGAAAACATACTTGAC pLX_317 18.9% 95.4% 94.2% V5 (not translated due to prior stop codon) 532_534delGAT;1550_1551ins49;1611_1635del n/a
7 TRCN0000492322 TACACAATCAATTACGAAATACCT pLX_317 31% 82.3% 82.3% V5 (not translated due to prior stop codon) 598_885del n/a
Download CSV