Construct: ORF TRCN0000492346
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019561.2_s317c1
- DNA Barcode:
- TATCGCCAAACGCTGCGCAATAAT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- NTRK3 (4916)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000492346
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022252.2 | 81.9% | .6% | 1_235del;1344_1345insTAGAAGCTT |
| 2 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022251.2 | 80.5% | .6% | 1_259del;1368_1369insTAGAAGCTT |
| 3 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_024449933.1 | 51.2% | .4% | 1_1048del;2157_2158insTAGAAGCTT |
| 4 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022243.1 | 50.6% | .4% | 1_1072del;2181_2182insTAGAAGCTT |
| 5 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022244.2 | 50.6% | .4% | 1_1072del;2181_2182insTAGAAGCTT |
| 6 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022245.2 | 50.6% | .4% | 1_1072del;2181_2182insTAGAAGCTT |
| 7 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022241.1 | 48.2% | .3% | 1_1180del;2289_2290insTAGAAGCTT |
| 8 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | NM_001243101.1 | 45% | .3% | 1_1342del;2451_2452insTAGAAGCTT |
| 9 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_006720544.4 | 45% | .3% | 1_1342del;2451_2452insTAGAAGCTT |
| 10 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | NM_002530.4 | 44.6% | .3% | 1_1366del;2475_2476insTAGAAGCTT |
| 11 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_006720543.4 | 44.6% | .3% | 1_1366del;2475_2476insTAGAAGCTT |
| 12 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022240.1 | 44.6% | .3% | 1_1366del;2475_2476insTAGAAGCTT |
| 13 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | NM_001012338.2 | 43.9% | .3% | 1_1366del;2133_2174del;2517_2518insTAGAAGCTT |
| 14 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022253.2 | 43.9% | .3% | 1_1366del;2133_2174del;2517_2518insTAGAAGCTT |
| 15 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022254.2 | 43.3% | .3% | 1_1366del;2134_2208del;2550_2551insTAGAAGCTT |
| 16 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | NM_001320135.1 | 35.3% | .4% | (many diffs) |
| 17 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022242.2 | 33.7% | .4% | (many diffs) |
| 18 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_006720545.4 | 31.1% | .4% | (many diffs) |
| 19 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XR_001751292.2 | 6.8% | 1_2009del;3121_3122insAAGCT;3123_16213del | |
| 20 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | NM_008746.5 | 40.7% | .3% | (many diffs) |
| 21 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XM_011250817.2 | 40% | .3% | (many diffs) |
| 22 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XM_006540691.3 | 39.5% | .3% | (many diffs) |
| 23 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XM_011250816.2 | 38.8% | .3% | (many diffs) |
| 24 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XR_001785487.1 | 14.3% | (many diffs) | |
| 25 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XR_001785488.1 | 13.8% | (many diffs) | |
| 26 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XR_882023.2 | 12.2% | (many diffs) | |
| 27 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XR_882022.2 | 7.6% | (many diffs) | |
| 28 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XR_001785486.1 | 7.5% | (many diffs) | |
| 29 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XR_882025.2 | 6.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 94
- ORF end:
- 118
- ORF length:
- 24
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaatccg 61 cggccgcccc cttcaccgaa ttcatcaaca aatatggtcg acggtccaaa tttggaatga 121 agggtcccgt ggctgtcatc agtggtgagg aggactcagc cagcccactg caccacatca 181 accacggcat caccacgccc tcgtcactgg atgccgggcc cgacactgtg gtcattggca 241 tgactcgcat ccctgtcatt gagaaccccc agtacttccg tcagggacac aactgccaca 301 agccggacac gtatgtgcag cacattaaga ggagagacat cgtgctgaag cgagaactgg 361 gtgagggagc ctttggaaag gtcttcctgg ccgagtgcta caacctcagc ccgaccaagg 421 acaagatgct tgtggctgtg aaggccctga aggatcccac cctggctgcc cggaaggatt 481 tccagaggga ggccgagctg ctcaccaacc tgcagcatga gcacattgtc aagttctatg 541 gagtgtgcgg cgatggggac cccctcatca tggtctttga atacatgaag catggagacc 601 tgaataagtt cctcagggcc catgggccag atgcaatgat ccttgtggat ggacagccac 661 gccaggccaa gggtgagctg gggctctccc aaatgctcca cattgccagt cagatcgcct 721 cgggtatggt gtacctggcc tcccagcact ttgtgcaccg agacctggcc accaggaact 781 gcctggttgg agcgaatctg ctagtgaaga ttggggactt cggcatgtcc agagatgtct 841 acagcacgga ttattacagg gtgggaggac acaccatgct ccccattcgc tggatgcctc 901 ctgaaagcat catgtaccgg aagttcacta cagagagtga tgtatggagc ttcggggtga 961 tccTCTGGGA GATCTTCACC TATGGAAAGC AGCCATGGTT CCAACTCTCA AACACGGAGG 1021 TCATTGAGTG CATTACCCAA GGTCGTGTTT TGGAGCGGCC CCGAGTCTGC CCCAAAGAGG 1081 TGTACGATGT CATGCTGGGG TGCTGGCAGA GGGAACCACA GCAGCGGTTG AACATCAAGG 1141 AGATCTACAA AATCCTCCAT GCTTTGGGGA AGGCCACCCC AATCTACCTG GACATTCTTG 1201 GCTAGAAGCT TAAGGGTGGG CGCGCCGACC CAGCTTTCTT GTACAAAGTG GTTGATATCG 1261 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1321 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GATATCGCCA 1381 AACGCTGCGC AATAATACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1441 aagatt