Construct: ORF TRCN0000492355
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019189.2_s317c1
- DNA Barcode:
- CGACCAAGTGATGCCGATTCTTCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SORCS1 (114815)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000492355
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 114815 | SORCS1 | sortilin related VPS10 doma... | NM_052918.5 | 99.9% | 100% | 2769C>T |
| 2 | human | 114815 | SORCS1 | sortilin related VPS10 doma... | NM_001206571.2 | 97.3% | 96.4% | (many diffs) |
| 3 | human | 114815 | SORCS1 | sortilin related VPS10 doma... | NM_001206570.2 | 96.3% | 96.2% | (many diffs) |
| 4 | human | 114815 | SORCS1 | sortilin related VPS10 doma... | NM_001206569.2 | 96.2% | 94.6% | (many diffs) |
| 5 | human | 114815 | SORCS1 | sortilin related VPS10 doma... | NM_001206572.2 | 96.2% | 94.6% | (many diffs) |
| 6 | human | 114815 | SORCS1 | sortilin related VPS10 doma... | XM_011539199.3 | 95.6% | 94.7% | (many diffs) |
| 7 | human | 114815 | SORCS1 | sortilin related VPS10 doma... | XM_017015614.2 | 95.1% | 93.1% | (many diffs) |
| 8 | human | 114815 | SORCS1 | sortilin related VPS10 doma... | NM_001013031.3 | 94.9% | 93.5% | (many diffs) |
| 9 | human | 114815 | SORCS1 | sortilin related VPS10 doma... | XM_011539201.3 | 93.5% | 92.9% | (many diffs) |
| 10 | human | 114815 | SORCS1 | sortilin related VPS10 doma... | XM_017015615.2 | 91.5% | 89.5% | (many diffs) |
| 11 | human | 114815 | SORCS1 | sortilin related VPS10 doma... | XM_017015616.1 | 79.9% | 78.1% | (many diffs) |
| 12 | human | 114815 | SORCS1 | sortilin related VPS10 doma... | XM_017015617.1 | 79.8% | 77.8% | (many diffs) |
| 13 | human | 114815 | SORCS1 | sortilin related VPS10 doma... | XM_017015618.1 | 55.7% | 53.8% | (many diffs) |
| 14 | mouse | 58178 | Sorcs1 | sortilin-related VPS10 doma... | NM_021377.3 | 88.1% | 93.6% | (many diffs) |
| 15 | mouse | 58178 | Sorcs1 | sortilin-related VPS10 doma... | NM_001252501.1 | 85.2% | 89.2% | (many diffs) |
| 16 | mouse | 58178 | Sorcs1 | sortilin-related VPS10 doma... | NM_001290356.1 | 85.2% | 90.9% | (many diffs) |
| 17 | mouse | 58178 | Sorcs1 | sortilin-related VPS10 doma... | XM_011247308.2 | 84.8% | 88.8% | (many diffs) |
| 18 | mouse | 58178 | Sorcs1 | sortilin-related VPS10 doma... | XM_006527244.3 | 83.8% | 88.4% | (many diffs) |
| 19 | mouse | 58178 | Sorcs1 | sortilin-related VPS10 doma... | XM_017318265.1 | 50.5% | 53.4% | (many diffs) |
| 20 | mouse | 58178 | Sorcs1 | sortilin-related VPS10 doma... | XM_006527243.1 | 50% | 53.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 75
- ORF end:
- 3579
- ORF length:
- 3504
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcgc caccatggga aaagttggcg ccggcggcgg ctcccaagcc cggctgagcg 121 cgctcctcgc cggcgcgggg ctcttgatcc tctgcgcccc gggcgtctgc ggcggcggct 181 cctgctgccc ctcgccgcac cccagctccg ctccacgctc ggcctcgacc cctaggggct 241 tttcccacca ggggcggcca ggcagggctc ctgccacgcc cctgcccctc gtagtgcgtc 301 ccctgttctc agtggccccc ggggaccgag cgctatccct ggagcgggct cggggcactg 361 gggcatccat ggcggttgct gcacgctccg gccggaggag acggagcgga gcggatcagg 421 agaaggcaga acggggagag ggcgcgagtc ggagcccccg gggagtgcta agagatggag 481 ggcagcagga gcctgggact cgggagcggg acccggacaa agccacccgc ttccggatgg 541 aggagctgag actgaccagc accacgtttg cgctgacggg agactcagca cacaaccaag 601 ccatggtcca ctggtctggc cacaacagca gcgtgattct cattttgaca aagctctatg 661 actataacct ggggagcatc acagagagct cgctttggag gtcaaccgat tatggaacaa 721 cctatgagaa gctgaatgat aaagttggtt tgaaaaccat tttgagctat ctctatgtgt 781 gtcctaccaa caagcgtaag ataatgttac tcacagaccc ggagattgag agcagtttat 841 tgatcagctc agatgaaggg gcaacttatc aaaagtaccg gctgaacttc tacattcaaa 901 gcttgctttt tcaccccaaa caagaagact ggattctggc atacagtcaa gaccaaaagt 961 tatacagctc tgctgaattt gggagaagat ggcagcttat ccaagaaggg gttgtaccaa 1021 acaggttcta ctggtctgtg atggggtcaa ataaagaacc agaccttgtg catcttgagg 1081 ccagaactgt ggatggtcat tcacattatc taacttgccg aatgcagaac tgtacagagg 1141 ccaacaggaa tcagcctttt ccaggctaca ttgacccaga ctctttgatt gttcaggatc 1201 attatgtgtt tgttcagctg acatcaggag ggcggccaca ttactacgtg tcctaccgaa 1261 ggaatgcatt tgcccaaatg aagcttccga aatatgcttt gcccaaggac atgcatgtta 1321 tcagcaccga tgagaatcag gtgttcgcag cggtccaaga atggaaccag aatgacacgt 1381 acaacctcta catctcagac acacgtggtg tctacttcac cctggccttg gagaatgtcc 1441 agagcagcag aggccctgag ggcaacatca tgatcgacct ctatgaggta gcagggataa 1501 agggaatgtt cttggctaac aagaagattg acaaccaagt gaagactttc atcacatata 1561 acaaaggcag agactggcgt ttgctgcagg cgccggacac ggatctaagg ggggaccccg 1621 tgcactgctt gctgccctat tgctcactac accttcacct gaaggtctct gagaatccct 1681 acacatcagg gatcattgcc agcaaagaca cagctccaag catcatagtg gcatcaggta 1741 atataggttc tgaattgtca gacactgaca tcagcatgtt tgtctcttca gatgcaggga 1801 acacctggag acagatcttt gaagaagagc acagtgtttt gtacctggat caaggtggag 1861 tcctggttgc tatgaaacac acatctctcc caattcgaca tctttggttg agttttgatg 1921 aagggagatc ttggagcaaa tacagtttca catctattcc actttttgtg gatggggttc 1981 tgggtgagcc tggagaagag actctcatca tgacagtgtt tggacacttc agccaccgct 2041 ctgaatggca gctggtcaaa gtagattaca agtccatttt tgatagacgg tgtgccgaag 2101 aggactacag accttggcag ctgcacagcc agggggaagc atgtatcatg ggagcaaaaa 2161 ggatatataa gaagcgaaaa tcagagcgga agtgtatgca aggaaaatat gcaggagcta 2221 tggaatctga accctgtgtc tgcactgagg ctgattttga ttgcgactat ggttatgagc 2281 gacacagcaa tggccagtgc ctgccggcat tttggttcaa tccatcctct ctgtcaaagg 2341 attgcagctt gggacagagt tacctcaata gtactgggta caggaaggtg gtttccaata 2401 attgcactga tggcgtaagg gaacagtaca ctgccaaacc gcagaagtgc ccagggaaag 2461 ccccgcgggg gctgcggata gtcacggctg atggaaagct gacagcggaa caaggacaca 2521 acgtcactct catggtgcaa ttagaagagg gtgatgttca gcggacactc atccaagtgg 2581 actttggcga tggtatcgcg gtgtcttacg tcaatctcag ctccatggaa gatgggatca 2641 aacacgtcta tcagaacgtg ggcattttcc gtgtgaccgt gcaggtggac aacagtctgg 2701 gttctgacag cgccgtcctg tacttacatg taacttgtcc cttggagcac gtgcacctgt 2761 ctcttccctt tgtcaccaca aagaacaaag aggtcaatgc gacggcagtg ctgtggccca 2821 gccaagtggg caccctcact tatgtgtggt ggtacggaaa caacacggag cctttgatca 2881 ccttggaggg aagcatatcc ttcagattta cttcagaagg aatgaatacc atcacagtgc 2941 aggtctcagc tgggaatgcc atcctacaag acacaaagac catcgcagta tatgaggaat 3001 tccggtctct tcgcttgtcc ttttctccaa acctggatga ctacaacccg gacatccctg 3061 agtggaggag ggacatcggt cgagtcatca aaaaatccct ggtggaagcc ACAGGGGTTC 3121 CAGGCCAGCA CATCCTGGTG GCGGTGCTCC CTGGCTTACC CACCACTGCT GAACTCTTTG 3181 TCCTACCCTA TCAGGATCCA GCTGGAGAAA ACAAAAGGTC AACTGATGAC CTGGAGCAGA 3241 TATCAGAATT GCTGATCCAC ACGCTCAACC AAAACTCAGT ACACTTCGAG CTGAAGCCAG 3301 GAGTCCGAGT CCTTGTCCAT GCTGCTCACT TAACAGCGGC CCCCCTGGTG GACCTCACTC 3361 CAACCCACAG TGGATCTGCC ATGCTGATGC TGCTCTCAGT GGTGTTTGTG GGGCTGGCAG 3421 TGTTCGTCAT CTACAAGTTT AAAAGGAGAG TAGCTTTACC CTCCCCTCCC TCCCCTTCTA 3481 CTCAACCTGG TGACTCATCT CTCCGATTGC AAAGAGCAAG ACACGCCACT CCGCCTTCAA 3541 CGCCAAAGCG GGGATCTGCT GGGGCACAGT ATGCAATTGA CCCAGCTTTC TTGTACAAAG 3601 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 3661 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 3721 ACGACGACCA AGTGATGCCG ATTCTTCTAC GCGTTAAGTC gacaatcaac ctctggatta 3781 caaaatttgt gaaagatt