Transcript: Mouse NM_001252501.1

Mus musculus sortilin-related VPS10 domain containing receptor 1 (Sorcs1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Sorcs1 (58178)
Length:
4396
CDS:
179..3757

Additional Resources:

NCBI RefSeq record:
NM_001252501.1
NBCI Gene record:
Sorcs1 (58178)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001252501.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000124720 GCTCGCTGTATTCGTCATCTA pLKO.1 3517 CDS 100% 4.950 6.930 N Sorcs1 n/a
2 TRCN0000417820 TTTGGAGGTCAACCGATTATG pLKO_005 798 CDS 100% 13.200 10.560 N SORCS1 n/a
3 TRCN0000432614 TATGAGGTAGCAGGGATAAAG pLKO_005 1586 CDS 100% 13.200 9.240 N SORCS1 n/a
4 TRCN0000124723 CCATTGCGGTATATGAGGAAT pLKO.1 3084 CDS 100% 4.950 3.465 N Sorcs1 n/a
5 TRCN0000124721 GCAGACTTTGACTGTGACTAT pLKO.1 2354 CDS 100% 4.950 3.465 N Sorcs1 n/a
6 TRCN0000124722 CATTGCGGTATATGAGGAATT pLKO.1 3085 CDS 100% 0.000 0.000 N Sorcs1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001252501.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492355 CGACCAAGTGATGCCGATTCTTCT pLX_317 13.5% 85.2% 89.2% V5 (many diffs) n/a
2 TRCN0000491704 AAAAATAGACCATACGTCCGGAAT pLX_317 4.7% 85.2% 89.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV