Transcript: Mouse XM_006527244.3

PREDICTED: Mus musculus sortilin-related VPS10 domain containing receptor 1 (Sorcs1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sorcs1 (58178)
Length:
4265
CDS:
669..4265

Additional Resources:

NCBI RefSeq record:
XM_006527244.3
NBCI Gene record:
Sorcs1 (58178)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527244.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000124720 GCTCGCTGTATTCGTCATCTA pLKO.1 4007 CDS 100% 4.950 6.930 N Sorcs1 n/a
2 TRCN0000417820 TTTGGAGGTCAACCGATTATG pLKO_005 1288 CDS 100% 13.200 10.560 N SORCS1 n/a
3 TRCN0000432614 TATGAGGTAGCAGGGATAAAG pLKO_005 2076 CDS 100% 13.200 9.240 N SORCS1 n/a
4 TRCN0000124723 CCATTGCGGTATATGAGGAAT pLKO.1 3574 CDS 100% 4.950 3.465 N Sorcs1 n/a
5 TRCN0000124721 GCAGACTTTGACTGTGACTAT pLKO.1 2844 CDS 100% 4.950 3.465 N Sorcs1 n/a
6 TRCN0000124722 CATTGCGGTATATGAGGAATT pLKO.1 3575 CDS 100% 0.000 0.000 N Sorcs1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527244.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492355 CGACCAAGTGATGCCGATTCTTCT pLX_317 13.5% 83.8% 88.4% V5 (many diffs) n/a
2 TRCN0000491704 AAAAATAGACCATACGTCCGGAAT pLX_317 4.7% 83.8% 88.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV