Transcript: Human NM_000015.3

Homo sapiens N-acetyltransferase 2 (NAT2), mRNA.

Source:
NCBI, updated 2019-09-18
Taxon:
Homo sapiens (human)
Gene:
NAT2 (10)
Length:
1285
CDS:
71..943

Additional Resources:

NCBI RefSeq record:
NM_000015.3
NBCI Gene record:
NAT2 (10)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000015.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034911 AGTTGGGCTTAGAGGCTATTT pLKO.1 216 CDS 100% 13.200 18.480 N NAT2 n/a
2 TRCN0000034910 GTCTCCAACATCTTCATTTAT pLKO.1 703 CDS 100% 15.000 10.500 N NAT2 n/a
3 TRCN0000034913 TCAGGAGAGAGCAGTATATTA pLKO.1 561 CDS 100% 15.000 10.500 N NAT2 n/a
4 TRCN0000034909 CCACAATGTTAGGAGGGTATT pLKO.1 327 CDS 100% 10.800 7.560 N NAT2 n/a
5 TRCN0000034912 CTGGTGATGGATCCCTTACTA pLKO.1 918 CDS 100% 5.625 3.938 N NAT2 n/a
6 TRCN0000308129 GTTCCCTTTGAGAACCTTAAC pLKO_005 173 CDS 100% 10.800 5.400 Y NAT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000015.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05750 pDONR223 100% 99.6% 99.3% None 282C>T;590G>A;803G>A n/a
2 ccsbBroad304_05750 pLX_304 0% 99.6% 99.3% V5 282C>T;590G>A;803G>A n/a
3 TRCN0000479055 ACTCAAGAAAAGGAACTATAGATT pLX_317 50.5% 99.6% 99.3% V5 282C>T;590G>A;803G>A n/a
4 ccsbBroadEn_00001 pDONR223 100% 86.6% 80.6% None (many diffs) n/a
5 ccsbBroad304_00001 pLX_304 0% 86.6% 80.6% V5 (many diffs) n/a
6 TRCN0000470162 TGCCCTGTAAGGCGGGTTATTTCA pLX_317 47.9% 86.6% 80.6% V5 (many diffs) n/a
Download CSV