Transcript: Human NM_000029.4

Homo sapiens angiotensinogen (AGT), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
AGT (183)
Length:
2116
CDS:
41..1498

Additional Resources:

NCBI RefSeq record:
NM_000029.4
NBCI Gene record:
AGT (183)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000029.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006683 GCTTAACAAGCCTGAGGTCTT pLKO.1 1375 CDS 100% 4.050 5.670 N AGT n/a
2 TRCN0000371241 CTTCTTGGGCTTCCGTATATA pLKO_005 373 CDS 100% 15.000 12.000 N AGT n/a
3 TRCN0000371288 TGGTGCTGCAAGGATCTTATG pLKO_005 1191 CDS 100% 10.800 8.640 N AGT n/a
4 TRCN0000006682 CCTCCGTGTAGTGTCTGTAAT pLKO.1 1948 3UTR 100% 13.200 9.240 N AGT n/a
5 TRCN0000371242 TCTTCTAATGAGTCGACTTTG pLKO_005 1621 3UTR 100% 10.800 7.560 N AGT n/a
6 TRCN0000006686 TGTTCCTTGGAAGGACAAGAA pLKO.1 529 CDS 100% 4.950 3.465 N AGT n/a
7 TRCN0000006684 CCACCTTCATACCTGCTCCAA pLKO.1 234 CDS 100% 2.640 1.848 N AGT n/a
8 TRCN0000006685 CCAGGAGTTCTGGGTGGACAA pLKO.1 931 CDS 100% 1.350 0.810 N AGT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000029.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05791 pDONR223 100% 99.7% 99.5% None 803T>C;1003C>T;1116A>G n/a
2 ccsbBroad304_05791 pLX_304 0% 99.7% 99.5% V5 803T>C;1003C>T;1116A>G n/a
3 TRCN0000474209 GCATACACCGCATGCCTCAACTTA pLX_317 28.2% 99.7% 99.5% V5 803T>C;1003C>T;1116A>G n/a
Download CSV