Transcript: Human NM_000055.4

Homo sapiens butyrylcholinesterase (BCHE), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
BCHE (590)
Length:
2405
CDS:
119..1927

Additional Resources:

NCBI RefSeq record:
NM_000055.4
NBCI Gene record:
BCHE (590)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000055.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433066 GAACGTTGAACTTAGCTAAAT pLKO_005 927 CDS 100% 13.200 18.480 N BCHE n/a
2 TRCN0000420300 TCCGACCGTGGATGGTGATTT pLKO_005 1075 CDS 100% 13.200 18.480 N BCHE n/a
3 TRCN0000046910 CCTTGAATACAGAGTCAACAA pLKO.1 1707 CDS 100% 4.950 6.930 N BCHE n/a
4 TRCN0000046908 CCAGACATATTACTTGAACTT pLKO.1 1109 CDS 100% 4.950 3.960 N BCHE n/a
5 TRCN0000046912 CCAGGGAACATGGGTTTATTT pLKO.1 689 CDS 100% 15.000 10.500 N BCHE n/a
6 TRCN0000046911 CCTCTGGAAAGAAGAGATAAT pLKO.1 1547 CDS 100% 13.200 9.240 N BCHE n/a
7 TRCN0000046909 GCTCGGGTTGAAAGAGTTATT pLKO.1 602 CDS 100% 13.200 9.240 N BCHE n/a
8 TRCN0000427955 CTGTCAGAACATAGATCAAAG pLKO_005 397 CDS 100% 10.800 6.480 N BCHE n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000055.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00153 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00153 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465794 CGTCGTATTTGTTCATTACAGATA pLX_317 22.9% 100% 100% V5 n/a
4 ccsbBroadEn_10695 pDONR223 100% 10.6% 10.6% None 1_1614del n/a
5 ccsbBroad304_10695 pLX_304 0% 10.6% 10.6% V5 1_1614del n/a
Download CSV