Transcript: Human NM_000216.4

Homo sapiens anosmin 1 (ANOS1), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
ANOS1 (3730)
Length:
6265
CDS:
102..2144

Additional Resources:

NCBI RefSeq record:
NM_000216.4
NBCI Gene record:
ANOS1 (3730)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000216.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424623 CACATAACACTAAGCGTAAAT pLKO_005 2516 3UTR 100% 13.200 18.480 N ANOS1 n/a
2 TRCN0000423767 AGGTTAAGTGGTCCTCGAAAT pLKO_005 703 CDS 100% 10.800 15.120 N ANOS1 n/a
3 TRCN0000073677 CTTCCGATCATTATGTCCTAA pLKO.1 1939 CDS 100% 4.950 6.930 N ANOS1 n/a
4 TRCN0000073673 GCAGCTCTTATGGGCTTCTAA pLKO.1 4536 3UTR 100% 5.625 3.938 N ANOS1 n/a
5 TRCN0000073674 CGAGTTCAACTGACTGACATA pLKO.1 840 CDS 100% 4.950 3.465 N ANOS1 n/a
6 TRCN0000073675 GCTTCATTCATCGTCCAGGAT pLKO.1 1767 CDS 100% 2.640 1.848 N ANOS1 n/a
7 TRCN0000073676 CTGTGATCTATGTGGTACAAA pLKO.1 742 CDS 100% 5.625 3.375 N ANOS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000216.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06467 pDONR223 100% 99.9% 99.8% None 1600G>A;1833C>T n/a
2 ccsbBroad304_06467 pLX_304 0% 99.9% 99.8% V5 1600G>A;1833C>T n/a
3 TRCN0000475708 TAGCTGTTACGCTGACAGCTCGAT pLX_317 9.9% 99.9% 99.8% V5 1600G>A;1833C>T n/a
Download CSV