Transcript: Human NM_000230.3

Homo sapiens leptin (LEP), mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
LEP (3952)
Length:
3427
CDS:
58..561

Additional Resources:

NCBI RefSeq record:
NM_000230.3
NBCI Gene record:
LEP (3952)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000230.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058354 GTCACCGGTTTGGACTTCATT pLKO.1 226 CDS 100% 5.625 7.875 N LEP n/a
2 TRCN0000058357 TGTGGCTTTGGCCCTATCTTT pLKO.1 86 CDS 100% 5.625 7.875 N LEP n/a
3 TRCN0000058353 CCTTCCAGAAACGTGATCCAA pLKO.1 325 CDS 100% 3.000 2.400 N LEP n/a
4 TRCN0000372836 TATCCAGGACTCTGTCAATTT pLKO_005 660 3UTR 100% 13.200 9.240 N LEP n/a
5 TRCN0000372776 ATATATACACAGGATCCTATT pLKO_005 749 3UTR 100% 10.800 7.560 N LEP n/a
6 TRCN0000058355 GTCACCAGGATCAATGACATT pLKO.1 172 CDS 100% 4.950 3.465 N LEP n/a
7 TRCN0000372777 ACACTGGCAGTCTACCAACAG pLKO_005 289 CDS 100% 4.050 2.835 N LEP n/a
8 TRCN0000058356 CATCCTGACCTTATCCAAGAT pLKO.1 261 CDS 100% 4.950 2.970 N LEP n/a
9 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3106 3UTR 100% 4.950 2.475 Y ERAP2 n/a
10 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3107 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000230.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06520 pDONR223 100% 99.8% 99.4% None 56T>C n/a
2 ccsbBroad304_06520 pLX_304 0% 99.8% 99.4% V5 56T>C n/a
3 TRCN0000466085 GTGATCCAATTTTGGTTGGTCGTA pLX_317 38.7% 99.8% 99.4% V5 56T>C n/a
Download CSV