Transcript: Human NM_000237.3

Homo sapiens lipoprotein lipase (LPL), mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
LPL (4023)
Length:
3565
CDS:
189..1616

Additional Resources:

NCBI RefSeq record:
NM_000237.3
NBCI Gene record:
LPL (4023)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000237.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052139 CGCCGACCAAAGAAGAGATTT pLKO.1 269 CDS 100% 13.200 18.480 N LPL n/a
2 TRCN0000431580 ATCTGGGCTATGAGATCAATA pLKO_005 1123 CDS 100% 13.200 10.560 N LPL n/a
3 TRCN0000052138 GCCTGAAGTTTCCACAAATAA pLKO.1 1328 CDS 100% 15.000 10.500 N LPL n/a
4 TRCN0000427712 TATTGGGCCATAGCCTATAAT pLKO_005 1944 3UTR 100% 15.000 10.500 N LPL n/a
5 TRCN0000426392 AGCACATCCTCCAACGTTAAA pLKO_005 1833 3UTR 100% 13.200 9.240 N LPL n/a
6 TRCN0000052142 GCTCTGCTTGAGTTGTAGAAA pLKO.1 1088 CDS 100% 5.625 3.938 N LPL n/a
7 TRCN0000052140 CCTAACTTTGAGTATGCAGAA pLKO.1 747 CDS 100% 4.050 2.835 N LPL n/a
8 TRCN0000052141 CCATGACAAGTCTCTGAATAA pLKO.1 1583 CDS 100% 13.200 7.920 N LPL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000237.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491511 TTTATAGAAGGTTTCTGTGACCTC pLX_317 23.2% 100% 100% V5 (not translated due to prior stop codon) n/a
2 TRCN0000489885 AACTGAGATCTTACTTGTTGGCAC pLX_317 28.7% 99.9% 99.7% V5 1425_1426insG n/a
3 ccsbBroadEn_06535 pDONR223 100% 99.9% 99.7% None 953A>G n/a
4 ccsbBroad304_06535 pLX_304 0% 99.9% 99.7% V5 953A>G n/a
5 TRCN0000467095 CCCTTGATCCAGACTGAGTATTTA pLX_317 30.1% 99.9% 99.7% V5 953A>G n/a
Download CSV