Transcript: Human NM_000258.3

Homo sapiens myosin light chain 3 (MYL3), mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
MYL3 (4634)
Length:
885
CDS:
55..642

Additional Resources:

NCBI RefSeq record:
NM_000258.3
NBCI Gene record:
MYL3 (4634)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000258.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054005 CGCCCTAAGGAGGTCGAGTTT pLKO.1 145 CDS 100% 1.650 2.310 N MYL3 n/a
2 TRCN0000415100 TGCATCAACTATGAAGCATTT pLKO_005 598 CDS 100% 10.800 7.560 N MYL3 n/a
3 TRCN0000054006 CCAAGACAGGAAGAGCTCAAT pLKO.1 349 CDS 100% 4.950 3.465 N MYL3 n/a
4 TRCN0000412288 GCTTCCAAGATCAAGATTGAG pLKO_005 169 CDS 100% 4.950 3.465 N MYL3 n/a
5 TRCN0000054007 CAATACCAAGATGATGGACTT pLKO.1 366 CDS 100% 4.050 2.835 N MYL3 n/a
6 TRCN0000054003 GCACATTTCCAAGAACAAGGA pLKO.1 411 CDS 100% 2.640 1.848 N MYL3 n/a
7 TRCN0000054004 CACACCCAAGTGTGAGATGAA pLKO.1 243 CDS 100% 0.495 0.347 N MYL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000258.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13907 pDONR223 100% 99.6% 2% None 9_9delCinsGN n/a
2 ccsbBroad304_13907 pLX_304 0% 99.6% 2% V5 (not translated due to prior stop codon) 9_9delCinsGN n/a
3 TRCN0000468865 TAATTGATAGTTTATCCTCCCACC pLX_317 74.7% 99.6% 2% V5 (not translated due to prior stop codon) 9_9delCinsGN n/a
Download CSV