Transcript: Human NM_000261.2

Homo sapiens myocilin (MYOC), mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
MYOC (4653)
Length:
2100
CDS:
78..1592

Additional Resources:

NCBI RefSeq record:
NM_000261.2
NBCI Gene record:
MYOC (4653)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000261.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373030 AGCAGGCCTCTGGGTCATTTA pLKO_005 1232 CDS 100% 13.200 18.480 N MYOC n/a
2 TRCN0000373081 ACCACGGACAGTTCCCGTATT pLKO_005 1171 CDS 100% 10.800 15.120 N MYOC n/a
3 TRCN0000373080 AGAAGTTTCTACGTGGAATTT pLKO_005 677 CDS 100% 13.200 9.240 N MYOC n/a
4 TRCN0000083265 GCTACCGTCAACTTTGCTTAT pLKO.1 1416 CDS 100% 10.800 7.560 N MYOC n/a
5 TRCN0000083267 CGCTGAGAACAGCAGAAACAA pLKO.1 844 CDS 100% 5.625 3.938 N MYOC n/a
6 TRCN0000083266 CCAGAGAATCTGGAACTCGAA pLKO.1 1299 CDS 100% 2.640 1.848 N MYOC n/a
7 TRCN0000083264 CCGCTATAAGTACAGCAGCAT pLKO.1 1484 CDS 100% 2.640 1.848 N MYOC n/a
8 TRCN0000083263 CCATCTAACTATTCAGGAATT pLKO.1 1741 3UTR 100% 0.000 0.000 N MYOC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000261.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06612 pDONR223 100% 99.9% 99.8% None 7T>A n/a
2 ccsbBroad304_06612 pLX_304 0% 99.9% 99.8% V5 7T>A n/a
3 TRCN0000492294 GGTATACCCTACTGTGTTATCACC pLX_317 31.5% 99.9% 99.8% V5 7T>A n/a
Download CSV