Transcript: Human NM_000266.4

Homo sapiens norrin cystine knot growth factor NDP (NDP), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
NDP (4693)
Length:
1719
CDS:
295..696

Additional Resources:

NCBI RefSeq record:
NM_000266.4
NBCI Gene record:
NDP (4693)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000266.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373037 CTGCTAAAGGTTACCGATTTC pLKO_005 1162 3UTR 100% 10.800 15.120 N NDP n/a
2 TRCN0000063746 GTGTAGCTCAAAGATGGTGCT pLKO.1 456 CDS 100% 2.160 1.728 N NDP n/a
3 TRCN0000373036 CTCTGCATATTCTAGTAATAA pLKO_005 814 3UTR 100% 15.000 10.500 N NDP n/a
4 TRCN0000373088 ACGGACAGCTCATTCATAATG pLKO_005 370 CDS 100% 13.200 9.240 N NDP n/a
5 TRCN0000063743 GCACCACTATGTGGATTCTAT pLKO.1 417 CDS 100% 5.625 3.938 N NDP n/a
6 TRCN0000063745 GTCACCCATTGTACAAGTGTA pLKO.1 440 CDS 100% 4.950 3.465 N NDP n/a
7 TRCN0000063744 TGCTGGTGATAATGGGAGATA pLKO.1 338 CDS 100% 4.950 3.465 N NDP n/a
8 TRCN0000063747 CATGCGACTCACTGCCACCTA pLKO.1 633 CDS 100% 0.880 0.616 N NDP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000266.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01063 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01063 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468792 ACTTGCCCCCGTTTATGTCCGTTC pLX_317 100% 100% 100% V5 n/a
Download CSV