Transcript: Human NM_000321.2

Homo sapiens RB transcriptional corepressor 1 (RB1), mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
RB1 (5925)
Length:
4772
CDS:
167..2953

Additional Resources:

NCBI RefSeq record:
NM_000321.2
NBCI Gene record:
RB1 (5925)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000321.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295892 GTGCGCTCTTGAGGTTGTAAT pLKO_005 1630 CDS 100% 13.200 18.480 N RB1 n/a
2 TRCN0000295891 TCGCTTGTATTACCGAGTAAT pLKO_005 1516 CDS 100% 13.200 18.480 N RB1 n/a
3 TRCN0000010419 CAGAGATCGTGTATTGAGATT pLKO.1 4612 3UTR 100% 4.950 6.930 N RB1 n/a
4 TRCN0000295842 CAGAGATCGTGTATTGAGATT pLKO_005 4612 3UTR 100% 4.950 6.930 N RB1 n/a
5 TRCN0000010418 GACTTCTACTCGAACACGAAT pLKO.1 2878 CDS 100% 4.950 6.930 N RB1 n/a
6 TRCN0000295841 GACTTCTACTCGAACACGAAT pLKO_005 2878 CDS 100% 4.950 6.930 N RB1 n/a
7 TRCN0000040167 CGAAATTGGATCACAGCGATA pLKO.1 1483 CDS 100% 4.050 5.670 N RB1 n/a
8 TRCN0000040164 CGCGTGTAAATTCTACTGCAA pLKO.1 2025 CDS 100% 2.640 3.696 N RB1 n/a
9 TRCN0000040166 CCTCCCATGTTGCTCAAAGAA pLKO.1 857 CDS 100% 5.625 3.938 N RB1 n/a
10 TRCN0000040163 CCACATTATTTCTAGTCCAAA pLKO.1 4103 3UTR 100% 4.950 3.465 N RB1 n/a
11 TRCN0000288710 CCACATTATTTCTAGTCCAAA pLKO_005 4103 3UTR 100% 4.950 3.465 N RB1 n/a
12 TRCN0000040165 CGGCTAAATACACTTTGTGAA pLKO.1 2147 CDS 100% 4.950 3.465 N RB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000321.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06846 pDONR223 99.7% 100% 100% None n/a
2 ccsbBroad304_06846 pLX_304 22.8% 100% 100% V5 n/a
Download CSV