Transcript: Human NM_000328.3

Homo sapiens retinitis pigmentosa GTPase regulator (RPGR), transcript variant A, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
RPGR (6103)
Length:
3053
CDS:
143..2590

Additional Resources:

NCBI RefSeq record:
NM_000328.3
NBCI Gene record:
RPGR (6103)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000328.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047476 GCTACGACTATCGAAGCATTT pLKO.1 1859 CDS 100% 10.800 15.120 N RPGR n/a
2 TRCN0000047473 CGGGCCATTTGTGAGTACAAT pLKO.1 2258 CDS 100% 5.625 7.875 N RPGR n/a
3 TRCN0000350048 TGGATCTCTTGTGGATATTAC pLKO_005 722 CDS 100% 13.200 10.560 N Rpgr n/a
4 TRCN0000047474 CCCGGTAAATTCTGGTTTAAA pLKO.1 221 CDS 100% 15.000 10.500 N RPGR n/a
5 TRCN0000423400 TCCTACTTTGTGCTCTAATTT pLKO_005 1159 CDS 100% 15.000 10.500 N RPGR n/a
6 TRCN0000047477 CCTGGATCTCTTGTGGATATT pLKO.1 720 CDS 100% 13.200 9.240 N RPGR n/a
7 TRCN0000047475 CCTCCAATAGAAGGGACTCTT pLKO.1 1427 CDS 100% 4.950 3.465 N RPGR n/a
8 TRCN0000423917 AGCTGTCTGCTGGATCTAATA pLKO_005 573 CDS 100% 13.200 7.920 N RPGR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000328.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11102 pDONR223 100% 58.8% 58.1% None 1414_1505del;1533_2445del n/a
2 ccsbBroad304_11102 pLX_304 0% 58.8% 58.1% V5 1414_1505del;1533_2445del n/a
3 TRCN0000480493 TTCGACCCCTTGAACGGTGCTACT pLX_317 24.6% 58.8% 58.1% V5 1414_1505del;1533_2445del n/a
Download CSV