Construct: ORF TRCN0000480493
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015788.1_s317c1
- Derived from:
- ccsbBroadEn_11102
- DNA Barcode:
- TTCGACCCCTTGAACGGTGCTACT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RPGR (6103)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480493
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6103 | RPGR | retinitis pigmentosa GTPase... | NM_001367247.1 | 68.1% | 67.3% | 1414_1505del;1533_2112del |
| 2 | human | 6103 | RPGR | retinitis pigmentosa GTPase... | NM_001367249.1 | 68% | 67.1% | 308_309insAGA;1411_1502del;1530_2109del |
| 3 | human | 6103 | RPGR | retinitis pigmentosa GTPase... | NM_001367250.1 | 68% | 67% | 619_620insCAG;1411_1502del;1530_2109del |
| 4 | human | 6103 | RPGR | retinitis pigmentosa GTPase... | NM_001367248.1 | 66.4% | 65.4% | (many diffs) |
| 5 | human | 6103 | RPGR | retinitis pigmentosa GTPase... | NM_001367251.1 | 59.3% | 58.5% | 1058_1059ins186;1228_1319del;1347_1926del |
| 6 | human | 6103 | RPGR | retinitis pigmentosa GTPase... | NM_000328.3 | 58.8% | 58.1% | 1414_1505del;1533_2445del |
| 7 | human | 6103 | RPGR | retinitis pigmentosa GTPase... | NM_001367245.1 | 58.7% | 57.9% | 619_620insCAG;1411_1502del;1530_2442del |
| 8 | human | 6103 | RPGR | retinitis pigmentosa GTPase... | NR_159807.1 | 54.7% | 1_142del;1583_2628del | |
| 9 | human | 6103 | RPGR | retinitis pigmentosa GTPase... | NM_001367246.1 | 51.2% | 50.5% | 1058_1059ins186;1228_1319del;1347_2259del |
| 10 | human | 6103 | RPGR | retinitis pigmentosa GTPase... | NR_159806.1 | 50.1% | 1_142del;1556_1647del;1675_2872del | |
| 11 | human | 6103 | RPGR | retinitis pigmentosa GTPase... | NR_159804.1 | 49.1% | (many diffs) | |
| 12 | human | 6103 | RPGR | retinitis pigmentosa GTPase... | NR_159805.1 | 48% | 1_142del;1556_1647del;1675_2999del | |
| 13 | human | 6103 | RPGR | retinitis pigmentosa GTPase... | NR_159803.1 | 43.8% | (many diffs) | |
| 14 | human | 6103 | RPGR | retinitis pigmentosa GTPase... | NM_001034853.2 | 41.6% | 41.1% | 1414_1505del;1533_3456del |
| 15 | human | 6103 | RPGR | retinitis pigmentosa GTPase... | NR_159808.1 | 39% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1506
- ORF length:
- 1440
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag ggagccggaa gagctgatgc ccgattcggg tgctgtgttt acatttggga 121 aaagtaaatt tgctgaaaat aatcccggta aattctggtt taaaaatgat gtccctgtac 181 atctttcatg tggagatgaa cattctgctg ttgttaccgg aaataataaa ctttacatgt 241 ttggcagtaa caactggggt cagttaggat taggatcaaa gtcagccatc agcaagccaa 301 catgtgtcaa agctctaaaa cctgaaaaag tgaaattagc tgcctgtgga aggaaccaca 361 ccctggtgtc aacagaagga ggcaatgtat atgcaactgg tggaaataat gaaggacagt 421 tggggcttgg tgacaccgaa gaaagaaaca cttttcatgt aattagcttt tttacatccg 481 agcataagat taagcagctg tctgctggat ctaatacttc agctgcccta actgaggatg 541 gaagactttt tatgtggggt gacaattccg aagggcaaat tggtttaaaa aatgtaagta 601 atgtctgtgt ccctcagcaa gtgaccattg ggaaacctgt ctcctggatc tcttgtggat 661 attaccattc agcttttgta acaacagatg gtgagctata tgtgtttgga gaacctgaga 721 atgggaagtt aggtcttccc aatcagctcc tgggcaatca cagaacaccc cagctggtgt 781 ctgaaattcc ggagaaggtg atccaagtag cctgtggtgg agagcatact gtggttctca 841 cggagaatgc tgtgtatacc tttgggctgg gacaatttgg tcagctgggt cttggcactt 901 ttctttttga aacttcagaa cccaaagtca ttgagaatat tagggatcaa acaataagtt 961 atatttcttg tggagaaaat cacacagctt tgataacaga tatcggcctt atgtatactt 1021 ttggagatgg tcgccacgga aaattaggac ttggactgga gaattttacc aatcacttca 1081 ttcctacttt gtgctctaat tttttgaggt ttatagttaa attggttgct tgtggtggat 1141 gtcacatggt agttttTGCT GCTCCTCATC GTGGTGTGGC AAAAGAAATT GAATTCGATG 1201 AAATAAATGA TACTTGCTTA TCTGTGGCGA CTTTTCTGCC GTATAGCAGT TTAACCTCAG 1261 GAAATGTACT GCAGAGGACT CTATCAGCAC GTATGCGGCG AAGAGAGAGG GAGAGGTCTC 1321 CAGATTCTTT TTCAATGAGG AGAACACTAC CTCCAATAGA AGGGACTCTT GGCCTTTCTG 1381 CTTGTTTTCT CCCCAATTCA GTCTTTCCAC GATGTTCTGA GAGAAACCTC CAAGAGAGTG 1441 TCTTATCTGA ACAGGACCTC ATGCAGCCAG AGGAACCAGA CACACATCAT GAGCCTGAAT 1501 TCCAATGCCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1561 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1621 CTTGGCTTTA TATATCTTGT GGAAAGGACG ATTCGACCCC TTGAACGGTG CTACTACGCG 1681 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt