Transcript: Human NM_000401.3

Homo sapiens exostosin glycosyltransferase 2 (EXT2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
EXT2 (2132)
Length:
3469
CDS:
57..2312

Additional Resources:

NCBI RefSeq record:
NM_000401.3
NBCI Gene record:
EXT2 (2132)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000401.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229997 AGCGTACTTCCAGTCAATTAA pLKO_005 1346 CDS 100% 15.000 21.000 N EXT2 n/a
2 TRCN0000039849 GCGTACTTCCAGTCAATTAAA pLKO.1 1347 CDS 100% 15.000 21.000 N EXT2 n/a
3 TRCN0000229996 GTCATTGCAGACTCCTATATT pLKO_005 1182 CDS 100% 15.000 21.000 N EXT2 n/a
4 TRCN0000039850 CCCATTCTATCGAGTCCTCAA pLKO.1 295 CDS 100% 4.050 5.670 N EXT2 n/a
5 TRCN0000039851 GCAGATTATCAATGACCGGAT pLKO.1 1388 CDS 100% 2.160 3.024 N EXT2 n/a
6 TRCN0000257098 TATGAGGTCTGGCGGGAATTT pLKO_005 1812 CDS 100% 13.200 10.560 N EXT2 n/a
7 TRCN0000438810 TATGAGGTCTGGCGGGAATTT pLKO_005 1812 CDS 100% 13.200 10.560 N Ext2 n/a
8 TRCN0000218705 CACCTTTCTCCCTTGATATAT pLKO_005 2999 3UTR 100% 15.000 10.500 N EXT2 n/a
9 TRCN0000229998 CCATTGATGATGATATCATTA pLKO_005 1762 CDS 100% 13.200 9.240 N EXT2 n/a
10 TRCN0000010492 GAAGATATTGCCATGAACTTC pLKO.1 2034 CDS 100% 4.950 3.465 N EXT2 n/a
11 TRCN0000010493 CAATTCCTGATAGTCCAAGGA pLKO.1 2976 3UTR 100% 2.640 1.848 N EXT2 n/a
12 TRCN0000039852 CCATGAGATGAATAAGTGGAA pLKO.1 1877 CDS 100% 2.640 1.848 N EXT2 n/a
13 TRCN0000039848 CCTCTGTTCTTGTATTTCTTA pLKO.1 2507 3UTR 100% 5.625 3.375 N EXT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000401.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00524 pDONR223 100% 95.6% 95.6% None 1_99del n/a
2 ccsbBroad304_00524 pLX_304 0% 95.6% 95.6% V5 1_99del n/a
3 TRCN0000491474 ATTACAGCCGCGCACCCACGCCAT pLX_317 14.9% 95.6% 95.6% V5 1_99del n/a
Download CSV