Transcript: Human NM_000465.4

Homo sapiens BRCA1 associated RING domain 1 (BARD1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
BARD1 (580)
Length:
5478
CDS:
115..2448

Additional Resources:

NCBI RefSeq record:
NM_000465.4
NBCI Gene record:
BARD1 (580)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000465.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000350414 GTCTGCGGCCTGTCGATTATA pLKO_005 1694 CDS 100% 15.000 21.000 N BARD1 n/a
2 TRCN0000369101 ACGTGACTCAGACCATCAATA pLKO_005 2249 CDS 100% 13.200 18.480 N BARD1 n/a
3 TRCN0000315222 GCACATCTTCTGTAGTAATTG pLKO_005 315 CDS 100% 13.200 18.480 N BARD1 n/a
4 TRCN0000003745 CCACCTTCATGCAAACGTAAA pLKO.1 1207 CDS 100% 10.800 15.120 N BARD1 n/a
5 TRCN0000350415 GCTCGCGTTGTACTAACATTC pLKO_005 263 CDS 100% 10.800 15.120 N BARD1 n/a
6 TRCN0000369045 TGGTTTAGCCCTCGAAGTAAG pLKO_005 550 CDS 100% 10.800 15.120 N BARD1 n/a
7 TRCN0000003747 GCTGTTTGATGGATGCTACTT pLKO.1 2124 CDS 100% 4.950 6.930 N BARD1 n/a
8 TRCN0000003746 AGGTAGAGTCATTCATATTTG pLKO.1 2541 3UTR 100% 13.200 9.240 N BARD1 n/a
9 TRCN0000377308 TGAAAGTATGAAATCGCTATT pLKO_005 1722 CDS 100% 10.800 7.560 N BARD1 n/a
10 TRCN0000003743 CCAGACACTAAGAGCAGGAAT pLKO.1 979 CDS 100% 4.950 3.465 N BARD1 n/a
11 TRCN0000003744 GTGGATATAGTCAAGCTGTTA pLKO.1 1633 CDS 100% 4.950 3.465 N BARD1 n/a
12 TRCN0000350413 ATCCAAAGGACAACCTTATTA pLKO_005 2171 CDS 100% 15.000 9.000 N BARD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000465.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15367 pDONR223 0% 99.7% 99.6% None (many diffs) n/a
2 ccsbBroad304_15367 pLX_304 0% 99.7% 99.6% V5 (many diffs) n/a
Download CSV