Transcript: Human NM_000497.3

Homo sapiens cytochrome P450 family 11 subfamily B member 1 (CYP11B1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
CYP11B1 (1584)
Length:
3551
CDS:
8..1519

Additional Resources:

NCBI RefSeq record:
NM_000497.3
NBCI Gene record:
CYP11B1 (1584)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000497.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064288 CCCTCAACAGTACACCAGCAT pLKO.1 853 CDS 100% 2.640 3.696 N CYP11B1 n/a
2 TRCN0000064292 TGGGACATTGGTGCGCGTGTT pLKO.1 1204 CDS 100% 1.350 1.890 N CYP11B1 n/a
3 TRCN0000424572 TGCGCAGACTGTCAGAGTCAT pLKO_005 1917 3UTR 100% 4.950 3.960 N CYP11B1 n/a
4 TRCN0000425078 ACTGTCGCCAGATGCCATCAA pLKO_005 901 CDS 100% 4.950 3.465 N CYP11B1 n/a
5 TRCN0000064291 CACCTTCAGAGCCATCAACTA pLKO.1 1498 CDS 100% 4.950 3.465 N CYP11B1 n/a
6 TRCN0000064289 CTTCATATTGAGGCCCAGCAT pLKO.1 1465 CDS 100% 2.640 1.848 N CYP11B1 n/a
7 TRCN0000064290 CCTGGAAGTACACCAGACCTT pLKO.1 202 CDS 100% 2.640 1.584 N CYP11B1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000497.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10764 pDONR223 100% 87.5% 87.6% None (many diffs) n/a
2 ccsbBroad304_10764 pLX_304 0% 87.5% 87.6% V5 (many diffs) n/a
3 TRCN0000470155 CTTTGGGGGGCTTGTCAAAATAGA pLX_317 23% 84.2% 84.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV