Transcript: Human NM_000548.5

Homo sapiens TSC complex subunit 2 (TSC2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-25
Taxon:
Homo sapiens (human)
Gene:
TSC2 (7249)
Length:
6415
CDS:
111..5534

Additional Resources:

NCBI RefSeq record:
NM_000548.5
NBCI Gene record:
TSC2 (7249)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000548.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040178 CGACGAGTCAAACAAGCCAAT pLKO.1 4643 CDS 100% 4.050 5.670 N TSC2 n/a
2 TRCN0000288621 CGACGAGTCAAACAAGCCAAT pLKO_005 4643 CDS 100% 4.050 5.670 N TSC2 n/a
3 TRCN0000040181 CCAACGAAGACCTTCACGAAA pLKO.1 505 CDS 100% 4.950 3.960 N TSC2 n/a
4 TRCN0000040182 GAGGGTAAACAGACGGAGTTT pLKO.1 204 CDS 100% 4.950 3.960 N TSC2 n/a
5 TRCN0000288686 GAGGGTAAACAGACGGAGTTT pLKO_005 204 CDS 100% 4.950 3.960 N TSC2 n/a
6 TRCN0000040180 CGCTATAAAGTGCTCATCTTT pLKO.1 2262 CDS 100% 5.625 3.938 N TSC2 n/a
7 TRCN0000010455 CAATGAGTCACAGTCCTTTGA pLKO.1 4673 CDS 100% 4.950 3.465 N TSC2 n/a
8 TRCN0000295896 CAATGAGTCACAGTCCTTTGA pLKO_005 4673 CDS 100% 4.950 3.465 N TSC2 n/a
9 TRCN0000010454 CAGCATTAATCTCTTACCATA pLKO.1 2422 CDS 100% 4.950 3.465 N TSC2 n/a
10 TRCN0000295897 CAGCATTAATCTCTTACCATA pLKO_005 2422 CDS 100% 4.950 3.465 N TSC2 n/a
11 TRCN0000040179 GCTCATCAACAGGCAGTTCTA pLKO.1 1529 CDS 100% 4.950 3.465 N TSC2 n/a
12 TRCN0000288619 GCTCATCAACAGGCAGTTCTA pLKO_005 1529 CDS 100% 4.950 3.465 N TSC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000548.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07101 pDONR223 100% 98.6% 98.5% None (many diffs) n/a
2 ccsbBroad304_07101 pLX_304 12.7% 98.6% 98.5% V5 (many diffs) n/a
3 TRCN0000476551 CGGAATCACTATGTGAGCATTTTA pLX_317 7.2% 98.6% 98.5% V5 (many diffs) n/a
Download CSV