Transcript: Human NM_000587.4

Homo sapiens complement C7 (C7), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
C7 (730)
Length:
5716
CDS:
115..2646

Additional Resources:

NCBI RefSeq record:
NM_000587.4
NBCI Gene record:
C7 (730)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000587.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371555 CCCAAATCTGAATCGAATTAC pLKO_005 2807 3UTR 100% 13.200 18.480 N C7 n/a
2 TRCN0000057174 GCGTTGGAGAAACGACAGAAA pLKO.1 1718 CDS 100% 4.950 6.930 N C7 n/a
3 TRCN0000057177 CCGAAGATTAATCGACCAGTA pLKO.1 990 CDS 100% 4.050 5.670 N C7 n/a
4 TRCN0000371494 TCATCTTCTTCACGCAGTTAT pLKO_005 799 CDS 100% 13.200 9.240 N C7 n/a
5 TRCN0000057173 CCTGCCTTGAAAGATGGATTT pLKO.1 1837 CDS 100% 10.800 7.560 N C7 n/a
6 TRCN0000057175 GCATCAGCAAATCATTGGTTT pLKO.1 401 CDS 100% 4.950 3.465 N C7 n/a
7 TRCN0000057176 GCTCAAGATGAGAGAAGCAAA pLKO.1 2299 CDS 100% 4.950 3.465 N C7 n/a
8 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3474 3UTR 100% 5.625 2.813 Y KLHL30 n/a
9 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3474 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000587.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00189 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00189 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467667 GGTTACACTTATATTGTTTGCACC pLX_317 12.7% 100% 100% V5 n/a
Download CSV