Transcript: Human NM_000621.4

Homo sapiens 5-hydroxytryptamine receptor 2A (HTR2A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
HTR2A (3356)
Length:
5442
CDS:
732..2147

Additional Resources:

NCBI RefSeq record:
NM_000621.4
NBCI Gene record:
HTR2A (3356)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000621.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000357492 AGGACGATTCGAAGGTCTTTA pLKO_005 1378 CDS 100% 13.200 18.480 N HTR2A n/a
2 TRCN0000009093 GCCACTAAGGTCAGTGTTATA pLKO.1 2639 3UTR 100% 13.200 18.480 N HTR2A n/a
3 TRCN0000357444 TTGCTTACTCGCCGATGATAA pLKO_005 1409 CDS 100% 13.200 18.480 N HTR2A n/a
4 TRCN0000009097 GCTCAACTACGAACTCCCTAA pLKO.1 766 CDS 100% 4.050 5.670 N HTR2A n/a
5 TRCN0000357493 GACCATATCAGTAGGTATATC pLKO_005 1331 CDS 100% 13.200 9.240 N HTR2A n/a
6 TRCN0000009094 CCCTGCTCAATGTGTTTGTTT pLKO.1 1810 CDS 100% 5.625 3.938 N HTR2A n/a
7 TRCN0000009095 CCTTACTTCATCTCCAGGAAA pLKO.1 931 CDS 100% 4.950 3.465 N HTR2A n/a
8 TRCN0000009096 GCCTACAAGTCTAGCCAACTT pLKO.1 1983 CDS 100% 4.950 3.465 N HTR2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000621.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488000 GTTGGTCTACTGTAAAAATCCTTC pLX_317 24.4% 100% 100% V5 (not translated due to prior stop codon) n/a
2 TRCN0000488624 AAAATCAGCTTATGCATAATTCGT pLX_317 24.2% 99.9% 99.7% V5 1413_1414insG n/a
Download CSV