Transcript: Human NM_000623.3

Homo sapiens bradykinin receptor B2 (BDKRB2), mRNA.

Source:
NCBI, updated 2019-06-26
Taxon:
Homo sapiens (human)
Gene:
BDKRB2 (624)
Length:
4197
CDS:
197..1372

Additional Resources:

NCBI RefSeq record:
NM_000623.3
NBCI Gene record:
BDKRB2 (624)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000623.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000008134 CGAGCGCATCATCGATGTAAT pLKO.1 1114 CDS 100% 13.200 18.480 N BDKRB2 n/a
2 TRCN0000008135 CCCACTCTTAACGGGACCTTT pLKO.1 302 CDS 100% 4.950 3.960 N BDKRB2 n/a
3 TRCN0000356717 CCGCGTGGTGAATGCCATTAT pLKO_005 586 CDS 100% 13.200 9.240 N BDKRB2 n/a
4 TRCN0000356782 CTTGCAAGGGCCCACTCTTAA pLKO_005 292 CDS 100% 13.200 9.240 N BDKRB2 n/a
5 TRCN0000356781 CTGGGTTTCTTTAATCTATTC pLKO_005 1803 3UTR 100% 10.800 7.560 N BDKRB2 n/a
6 TRCN0000008133 GCCACCCTAGAGAACATCTTT pLKO.1 407 CDS 100% 5.625 3.938 N BDKRB2 n/a
7 TRCN0000008136 GAATGCCATTATCTCCATGAA pLKO.1 595 CDS 100% 4.950 3.465 N BDKRB2 n/a
8 TRCN0000008132 GCTAGAACTTTGAAGGACAAT pLKO.1 1825 3UTR 100% 4.950 3.465 N BDKRB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000623.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488809 ATCATAATCGTTGACTTGATAACT pLX_317 25.7% 99.8% 99.7% V5 792A>G;1173_1174insG n/a
2 TRCN0000491912 GTGAGCGCCCATTGACCCGGGAAT pLX_317 25.9% 99.9% 100% V5 (not translated due to prior stop codon) 792A>G n/a
Download CSV