Transcript: Human NM_000635.4

Homo sapiens regulatory factor X2 (RFX2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
RFX2 (5990)
Length:
3959
CDS:
117..2288

Additional Resources:

NCBI RefSeq record:
NM_000635.4
NBCI Gene record:
RFX2 (5990)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000635.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014843 CCACCAAATTAGTGCCTCTTA pLKO.1 2364 3UTR 100% 4.950 3.465 N RFX2 n/a
2 TRCN0000014846 CGAAGGAATCACATCACACAA pLKO.1 671 CDS 100% 4.950 3.465 N RFX2 n/a
3 TRCN0000014844 GCTCTCCTTCTGGAACTCTAA pLKO.1 1304 CDS 100% 4.950 3.465 N RFX2 n/a
4 TRCN0000014845 GCTGCTCGACAAAGATGACAT pLKO.1 2159 CDS 100% 4.950 3.465 N RFX2 n/a
5 TRCN0000014847 CCAGTTCCACTACATCGAGAA pLKO.1 1277 CDS 100% 4.050 2.835 N RFX2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000635.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06859 pDONR223 100% 99.9% 99.7% None 8A>N;1829G>A n/a
2 ccsbBroad304_06859 pLX_304 30.2% 99.9% 99.7% V5 8A>N;1829G>A n/a
3 TRCN0000491438 GGGTTAACCCAGCTTGCTCCGTTC pLX_317 11.3% 99.9% 99.7% V5 8A>N;1829G>A n/a
Download CSV