Transcript: Human NM_000640.3

Homo sapiens interleukin 13 receptor subunit alpha 2 (IL13RA2), mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
IL13RA2 (3598)
Length:
1338
CDS:
98..1240

Additional Resources:

NCBI RefSeq record:
NM_000640.3
NBCI Gene record:
IL13RA2 (3598)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000640.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429459 GCCTATCAGATCCAGTTATTT pLKO_005 760 CDS 100% 15.000 21.000 N IL13RA2 n/a
2 TRCN0000433190 TTGGAGGCATCAGACTATAAA pLKO_005 701 CDS 100% 15.000 21.000 N IL13RA2 n/a
3 TRCN0000058526 CGACAATTATGCTTTGTAGTA pLKO.1 1001 CDS 100% 4.950 6.930 N IL13RA2 n/a
4 TRCN0000058523 GCTACGTTTCTGGCTACCATT pLKO.1 1120 CDS 100% 4.950 6.930 N IL13RA2 n/a
5 TRCN0000058527 CGGATACTTAGGTTATCTCTA pLKO.1 226 CDS 100% 4.950 3.960 N IL13RA2 n/a
6 TRCN0000418820 AGGATATGGATTGCGTATATT pLKO_005 519 CDS 100% 15.000 10.500 N IL13RA2 n/a
7 TRCN0000058524 CCTGGGCAGAAACTACTTATT pLKO.1 462 CDS 100% 13.200 9.240 N IL13RA2 n/a
8 TRCN0000427870 GCATACCTTTGGGACCTATTC pLKO_005 873 CDS 100% 10.800 7.560 N IL13RA2 n/a
9 TRCN0000058525 GCCGCCAGTCTATCTTACTTT pLKO.1 814 CDS 100% 5.625 3.938 N IL13RA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000640.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00862 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00862 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473393 CCCAATTCTTTTCTGGGGTCTAGG pLX_317 22.5% 100% 100% V5 n/a
Download CSV