Transcript: Human NM_000673.4

Homo sapiens alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide (ADH7), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
ADH7 (131)
Length:
2307
CDS:
242..1402

Additional Resources:

NCBI RefSeq record:
NM_000673.4
NBCI Gene record:
ADH7 (131)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000673.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426884 GCACCTGGGAATTAGTATAAT pLKO_005 1581 3UTR 100% 15.000 21.000 N ADH7 n/a
2 TRCN0000026419 CCTTTGCATTAGGAGCGATAT pLKO.1 607 CDS 100% 10.800 15.120 N ADH7 n/a
3 TRCN0000438266 GTTCCACTTGCGTCGTCTTTG pLKO_005 852 CDS 100% 10.800 15.120 N ADH7 n/a
4 TRCN0000026463 GCATCTAGGATCATTGGGATT pLKO.1 923 CDS 100% 4.050 3.240 N ADH7 n/a
5 TRCN0000415540 ATGCATCTCCTAGAGTAATAT pLKO_005 1765 3UTR 100% 15.000 10.500 N ADH7 n/a
6 TRCN0000026491 CCTCCTGAGAAAGTCTGTTTA pLKO.1 770 CDS 100% 13.200 9.240 N ADH7 n/a
7 TRCN0000026438 CGCACAGATGACCATGTGATA pLKO.1 419 CDS 100% 4.950 3.465 N ADH7 n/a
8 TRCN0000026500 GAAGGATTTGAGCTGCTCAAT pLKO.1 1346 CDS 100% 4.950 3.465 N ADH7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000673.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00029 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00029 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477122 ACACGGTGCCTTAGCACTTCCATG pLX_317 37.3% 100% 100% V5 n/a
Download CSV