Transcript: Human NM_000727.4

Homo sapiens calcium voltage-gated channel auxiliary subunit gamma 1 (CACNG1), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
CACNG1 (786)
Length:
1302
CDS:
108..776

Additional Resources:

NCBI RefSeq record:
NM_000727.4
NBCI Gene record:
CACNG1 (786)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000727.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044125 CCGTCTGGATCGAGTACTATT pLKO.1 619 CDS 100% 13.200 18.480 N CACNG1 n/a
2 TRCN0000446223 GGTGAAGCGCATGATTGACAG pLKO_005 590 CDS 100% 4.050 5.670 N CACNG1 n/a
3 TRCN0000044126 CGCGTCCATGTTCTATGCCTT pLKO.1 524 CDS 100% 2.640 3.696 N CACNG1 n/a
4 TRCN0000044124 GCGGATTTGTACCAAGCGCAT pLKO.1 269 CDS 100% 2.160 3.024 N CACNG1 n/a
5 TRCN0000431627 GAATAGAGCAAGACGTGAGTC pLKO_005 958 3UTR 100% 4.050 2.835 N CACNG1 n/a
6 TRCN0000044127 CGCCATCTTCAGCCTTGGCTT pLKO.1 437 CDS 100% 0.880 0.616 N CACNG1 n/a
7 TRCN0000044123 CTGTTCCTACTTCAGGCATTT pLKO.1 344 CDS 100% 10.800 6.480 N CACNG1 n/a
8 TRCN0000441448 TGCAGGGACAACCTGTGTTTG pLKO_005 1117 3UTR 100% 10.800 6.480 N CACNG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000727.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00203 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00203 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469271 CGGGACTGACGACCCAGCGATCCT pLX_317 57.6% 100% 100% V5 n/a
4 ccsbBroadEn_05926 pDONR223 100% 99.8% 100% None 273C>T n/a
5 ccsbBroad304_05926 pLX_304 0% 99.8% 100% V5 273C>T n/a
6 TRCN0000477667 CGGTCGTCAAAGCTATTCCAACTA pLX_317 47.1% 99.8% 100% V5 273C>T n/a
Download CSV