Transcript: Human NM_000733.4

Homo sapiens CD3e molecule (CD3E), mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
CD3E (916)
Length:
1361
CDS:
107..730

Additional Resources:

NCBI RefSeq record:
NM_000733.4
NBCI Gene record:
CD3E (916)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000733.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427536 GTGATGTCGGTGGCCACAATT pLKO_005 485 CDS 100% 13.200 18.480 N CD3E n/a
2 TRCN0000434877 TGGAGCAAAGTGGTTATTATG pLKO_005 375 CDS 100% 13.200 9.240 N CD3E n/a
3 TRCN0000057217 GACCTGTATTCTGGCCTGAAT pLKO.1 695 CDS 100% 4.950 3.465 N CD3E n/a
4 TRCN0000057216 TGAAATACTATGGCAACACAA pLKO.1 271 CDS 100% 4.950 3.465 N CD3E n/a
5 TRCN0000057215 GCCTCTTATCAGTTGGCGTTT pLKO.1 144 CDS 100% 4.050 2.835 N CD3E n/a
6 TRCN0000057214 GCTGGTTTACTACTGGAGCAA pLKO.1 544 CDS 100% 2.640 1.848 N CD3E n/a
7 TRCN0000057213 CCCAAAGTATTCCATCTACTT pLKO.1 1083 3UTR 100% 0.495 0.347 N CD3E n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000733.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05953 pDONR223 100% 99.8% 100% None 54C>T n/a
2 ccsbBroad304_05953 pLX_304 0% 99.8% 100% V5 54C>T n/a
3 TRCN0000466098 AACGCCCTCACGTCCTGCCGCATG pLX_317 56.6% 99.8% 100% V5 54C>T n/a
Download CSV